Transcript: Mouse XM_017321965.1

PREDICTED: Mus musculus cytoplasmic polyadenylation element binding protein 1 (Cpeb1), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cpeb1 (12877)
Length:
6047
CDS:
1935..3332

Additional Resources:

NCBI RefSeq record:
XM_017321965.1
NBCI Gene record:
Cpeb1 (12877)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321965.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240546 AGTCTGTACAACACCTATAAA pLKO_005 1853 5UTR 100% 15.000 21.000 N Cpeb1 n/a
2 TRCN0000183837 CGTGTGACTTTCAATAACCAA pLKO.1 3114 CDS 100% 3.000 4.200 N CPEB1 n/a
3 TRCN0000240542 GAGGCGTTCCTTGGGATATTA pLKO_005 2653 CDS 100% 15.000 12.000 N Cpeb1 n/a
4 TRCN0000240544 CCATCTTGAATGACCTATTTG pLKO_005 3034 CDS 100% 13.200 10.560 N Cpeb1 n/a
5 TRCN0000240543 GTCTTTGTTTCTGCACTAATT pLKO_005 4880 3UTR 100% 13.200 9.240 N Cpeb1 n/a
6 TRCN0000240545 TGATTTCAAGCCTTCGCATTT pLKO_005 2308 CDS 100% 10.800 7.560 N Cpeb1 n/a
7 TRCN0000202301 GCCATACAGTGCCTTTCCATT pLKO.1 5162 3UTR 100% 4.950 3.465 N Cpeb1 n/a
8 TRCN0000191978 GTAACAAACAAAGGAGACTTT pLKO.1 5238 3UTR 100% 4.950 3.465 N Cpeb1 n/a
9 TRCN0000183444 GCCAATATCTTTCGAAGGATA pLKO.1 1797 5UTR 100% 4.950 2.970 N CPEB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321965.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08857 pDONR223 100% 87.2% 89.1% None (many diffs) n/a
2 ccsbBroad304_08857 pLX_304 0% 87.2% 89.1% V5 (many diffs) n/a
3 TRCN0000492111 AACCCGCAACATGCCCGGTGGTCA pLX_317 23.2% 87.2% 89.1% V5 (many diffs) n/a
4 ccsbBroadEn_03954 pDONR223 100% 75.6% 77.3% None (many diffs) n/a
5 ccsbBroad304_03954 pLX_304 0% 75.6% 77.3% V5 (many diffs) n/a
6 TRCN0000466562 CGTCACCCAGTGACCATTACTCCA pLX_317 24% 75.6% 77.3% V5 (many diffs) n/a
Download CSV