Construct: ORF TRCN0000466659
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016727.1_s317c1
- Derived from:
- ccsbBroadEn_11775
- DNA Barcode:
- TGGGATTTACACAAACAACACGCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SUMF2 (25870)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466659
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 25870 | SUMF2 | sulfatase modifying factor 2 | NM_001130069.4 | 91.3% | 91.1% | 1_87del;153C>A |
2 | human | 25870 | SUMF2 | sulfatase modifying factor 2 | XM_011515254.3 | 65.2% | 54.4% | (many diffs) |
3 | human | 25870 | SUMF2 | sulfatase modifying factor 2 | NM_015411.4 | 57.6% | 55.4% | (many diffs) |
4 | human | 25870 | SUMF2 | sulfatase modifying factor 2 | NM_001042468.3 | 57.2% | 55% | (many diffs) |
5 | human | 25870 | SUMF2 | sulfatase modifying factor 2 | NM_001366648.2 | 55% | 54.3% | (many diffs) |
6 | human | 25870 | SUMF2 | sulfatase modifying factor 2 | NM_001042469.3 | 53.7% | 51.4% | (many diffs) |
7 | human | 25870 | SUMF2 | sulfatase modifying factor 2 | NM_001366647.2 | 51.5% | 50.6% | (many diffs) |
8 | human | 25870 | SUMF2 | sulfatase modifying factor 2 | NM_001366649.2 | 45.9% | 39.6% | (many diffs) |
9 | human | 25870 | SUMF2 | sulfatase modifying factor 2 | NM_001146333.2 | 45.9% | 43.3% | 0_1ins177;412_556del;639_640ins259 |
10 | human | 25870 | SUMF2 | sulfatase modifying factor 2 | NM_001042470.3 | 45.3% | 32.9% | (many diffs) |
11 | human | 25870 | SUMF2 | sulfatase modifying factor 2 | XR_001744616.1 | 32.5% | (many diffs) | |
12 | human | 25870 | SUMF2 | sulfatase modifying factor 2 | XR_001744617.1 | 30.7% | (many diffs) | |
13 | human | 25870 | SUMF2 | sulfatase modifying factor 2 | XR_002956418.1 | 29.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 996
- ORF length:
- 930
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt ccaactgcag ggtgggagat tcctgatggg aacaaattct ccagacagca 121 gagatggtga agggcctgtg cgggaggcga cagtgaaacc ctttgccatc gacatatttc 181 ctgtcaccaa caaagatttc agggattttg tcagggagaa aaagtatcgg acagaagctg 241 agatgtttgg atggagcttt gtctttgagg actttgtctc tgatgagctg agaaacaaag 301 ccacccagcc aatgaagtct gtactctggt ggcttccagt ggaaaaggca ttttggaggc 361 agcctgcagg tcctggctct ggcatccgag agagactgga gcacccagtg ttacacgtga 421 gctggaatga cgcccgtgcc tactgtgctt ggcggggaaa acgactgccc acggaggaag 481 agtgggagtt tgccgcccga gggggcttga agggtcaagt ttacccatgg gggaactggt 541 tccagccaaa ccgcaccaac ctgtggcagg gaaagttccc caagggagac aaagctgagg 601 atggcttcca tggagtctcc ccagtgaatg ctttccccgc ccagaacaac tacggatggg 661 caacactcca gattcagccT CAGACAACCT CGGTTTCCGC TGTGCTGCAG ACGCAGGCCG 721 GCCGCCAGGG GAGCTGTAAG CAGCCGGGTG GTGACAAGGA GAAAAGCCTT CTAGGGTCAC 781 TGTCATTCCC TGGCCATGTT GCAAACAGCG CAATTCCAAG CTCGAGAGCT TCAGCCTCAG 841 GAAAGAACTT CCCCTTCCCT GTCTCCCATC CCTCTGTGGC AGGCGCCTCT CACCAGGGCA 901 GGAGAGGACT CAGCCTCCTG TGTTTTGGAG AAGGGGCCCA ATGTGTGTTG ACGATGGCTG 961 GGGGCCAGGT GTTTCTGTTA GAGGCCAAGT ATTATTGCCC AACTTTCTTG TACAAAGTGG 1021 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1081 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1141 ATGGGATTTA CACAAACAAC ACGCTACGCG TTAAGTCgac aatcaacctc tggattacaa 1201 aatttgtgaa agatt