Transcript: Human NM_001042468.3

Homo sapiens sulfatase modifying factor 2 (SUMF2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SUMF2 (25870)
Length:
1999
CDS:
27..941

Additional Resources:

NCBI RefSeq record:
NM_001042468.3
NBCI Gene record:
SUMF2 (25870)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001042468.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140005 GTGTTACACGTGAGCTGGAAT pLKO.1 465 CDS 100% 4.950 6.930 N SUMF2 n/a
2 TRCN0000139433 CAGAACAACTACGGGCTCTAT pLKO.1 699 CDS 100% 4.950 3.960 N SUMF2 n/a
3 TRCN0000139923 GACAGTGAAACCCTTTGCCAT pLKO.1 197 CDS 100% 2.640 2.112 N SUMF2 n/a
4 TRCN0000254897 CCCTTTGCCATCGACATATTT pLKO_005 207 CDS 100% 15.000 10.500 N Sumf2 n/a
5 TRCN0000140208 GAGCACTCTGAAAGGCCATTT pLKO.1 1234 3UTR 100% 10.800 7.560 N SUMF2 n/a
6 TRCN0000140400 GCTGTGGAAGGAGAATGCTTT pLKO.1 1364 3UTR 100% 4.950 3.465 N SUMF2 n/a
7 TRCN0000139550 CCATGTTGCAAACAGCGCAAT pLKO.1 996 3UTR 100% 4.050 2.835 N SUMF2 n/a
8 TRCN0000140037 GAAACCCTTTGCCATCGACAT pLKO.1 203 CDS 100% 4.050 2.835 N SUMF2 n/a
9 TRCN0000142563 GAGCTTTGTCTTTGAGGACTT pLKO.1 311 CDS 100% 4.050 2.835 N SUMF2 n/a
10 TRCN0000141743 GAACAAATTCTCCAGACAGCA pLKO.1 148 CDS 100% 2.640 1.848 N SUMF2 n/a
11 TRCN0000140102 GTATCGGACAGAAGCTGAGAT pLKO.1 281 CDS 100% 4.950 2.970 N SUMF2 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1850 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1850 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001042468.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11775 pDONR223 100% 57.2% 55% None (many diffs) n/a
2 ccsbBroad304_11775 pLX_304 0% 57.2% 55% V5 (many diffs) n/a
3 TRCN0000466659 TGGGATTTACACAAACAACACGCT pLX_317 34.4% 57.2% 55% V5 (many diffs) n/a
4 ccsbBroadEn_11776 pDONR223 100% 17.4% 17.4% None 1_753del n/a
5 ccsbBroad304_11776 pLX_304 0% 17.4% 17.4% V5 1_753del n/a
6 TRCN0000472863 GTTATCTTATAACGAACTAGGTGT pLX_317 100% 17.4% 17.4% V5 1_753del n/a
Download CSV