Transcript: Human XR_001744616.1

PREDICTED: Homo sapiens sulfatase modifying factor 2 (SUMF2), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SUMF2 (25870)
Length:
2236
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001744616.1
NBCI Gene record:
SUMF2 (25870)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001744616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139433 CAGAACAACTACGGGCTCTAT pLKO.1 818 3UTR 100% 4.950 3.960 N SUMF2 n/a
2 TRCN0000139923 GACAGTGAAACCCTTTGCCAT pLKO.1 476 3UTR 100% 2.640 2.112 N SUMF2 n/a
3 TRCN0000254897 CCCTTTGCCATCGACATATTT pLKO_005 486 3UTR 100% 15.000 10.500 N Sumf2 n/a
4 TRCN0000140208 GAGCACTCTGAAAGGCCATTT pLKO.1 1471 3UTR 100% 10.800 7.560 N SUMF2 n/a
5 TRCN0000140400 GCTGTGGAAGGAGAATGCTTT pLKO.1 1601 3UTR 100% 4.950 3.465 N SUMF2 n/a
6 TRCN0000139550 CCATGTTGCAAACAGCGCAAT pLKO.1 1233 3UTR 100% 4.050 2.835 N SUMF2 n/a
7 TRCN0000140037 GAAACCCTTTGCCATCGACAT pLKO.1 482 3UTR 100% 4.050 2.835 N SUMF2 n/a
8 TRCN0000142563 GAGCTTTGTCTTTGAGGACTT pLKO.1 581 3UTR 100% 4.050 2.835 N SUMF2 n/a
9 TRCN0000141743 GAACAAATTCTCCAGACAGCA pLKO.1 427 3UTR 100% 2.640 1.848 N SUMF2 n/a
10 TRCN0000140102 GTATCGGACAGAAGCTGAGAT pLKO.1 551 3UTR 100% 4.950 2.970 N SUMF2 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2087 3UTR 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2087 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001744616.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11775 pDONR223 100% 32.5% None (many diffs) n/a
2 ccsbBroad304_11775 pLX_304 0% 32.5% V5 (many diffs) n/a
3 TRCN0000466659 TGGGATTTACACAAACAACACGCT pLX_317 34.4% 32.5% V5 (many diffs) n/a
4 ccsbBroadEn_11776 pDONR223 100% 7.1% None 1_898del;973_1090del;1176_2236del n/a
5 ccsbBroad304_11776 pLX_304 0% 7.1% V5 1_898del;973_1090del;1176_2236del n/a
6 TRCN0000472863 GTTATCTTATAACGAACTAGGTGT pLX_317 100% 7.1% V5 1_898del;973_1090del;1176_2236del n/a
Download CSV