Transcript: Mouse NM_177354.4

Mus musculus vasohibin 1 (Vash1), mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Vash1 (238328)
Length:
6189
CDS:
1289..2416

Additional Resources:

NCBI RefSeq record:
NM_177354.4
NBCI Gene record:
Vash1 (238328)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_177354.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194532 GATTGAATGGAAGCACTCGGT pLKO.1 2134 CDS 100% 0.660 0.528 N Vash1 n/a
2 TRCN0000193089 CAGGGACACAATTCTTTGAAA pLKO.1 1728 CDS 100% 5.625 3.938 N Vash1 n/a
3 TRCN0000173412 GCTTTCCCATCAGCTTCAAGA pLKO.1 1881 CDS 100% 4.950 3.465 N Vash1 n/a
4 TRCN0000193630 CAAGACCTATTTCTCAGGGAA pLKO.1 1897 CDS 100% 2.640 1.848 N Vash1 n/a
5 TRCN0000139046 CCTGGGAATTTACCTCACCAA pLKO.1 1840 CDS 100% 2.640 1.848 N VASH1 n/a
6 TRCN0000139620 CTGCCAATCAAATGCCTGGAA pLKO.1 1811 CDS 100% 2.640 1.848 N VASH1 n/a
7 TRCN0000144795 GAAATTAAGAAGAGCAGACCT pLKO.1 1745 CDS 100% 2.640 1.848 N VASH1 n/a
8 TRCN0000140443 GAGCTGCAGTACAATCACACA pLKO.1 1709 CDS 100% 2.640 1.848 N VASH1 n/a
9 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 4315 3UTR 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_177354.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02692 pDONR223 100% 86.6% 91.2% None (many diffs) n/a
2 ccsbBroad304_02692 pLX_304 0% 86.6% 91.2% V5 (many diffs) n/a
3 TRCN0000466840 GGAAAGCAACCCCCCTCCGTTCAG pLX_317 33% 86.6% 91.2% V5 (many diffs) n/a
4 ccsbBroadEn_11634 pDONR223 100% 46.8% 45% None (many diffs) n/a
5 ccsbBroad304_11634 pLX_304 0% 46.8% 45% V5 (many diffs) n/a
6 TRCN0000475048 GTCCGATGCATTTCAGATAGATCT pLX_317 18.6% 46.8% 45% V5 (many diffs) n/a
Download CSV