Construct: ORF TRCN0000467053
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016115.1_s317c1
- Derived from:
- ccsbBroadEn_06832
- DNA Barcode:
- TCCTGGTGCGGGTACCTTCGAGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAC2 (5880)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467053
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5880 | RAC2 | Rac family small GTPase 2 | NM_002872.5 | 99.8% | 100% | 81C>G |
2 | human | 5880 | RAC2 | Rac family small GTPase 2 | XM_006724286.3 | 82.6% | 75% | (many diffs) |
3 | human | 5881 | RAC3 | Rac family small GTPase 3 | NM_005052.3 | 81.8% | 88.5% | (many diffs) |
4 | human | 5879 | RAC1 | Rac family small GTPase 1 | NM_006908.5 | 75.9% | 92.1% | (many diffs) |
5 | human | 5879 | RAC1 | Rac family small GTPase 1 | NM_018890.4 | 69.7% | 83.8% | (many diffs) |
6 | mouse | 19354 | Rac2 | RAS-related C3 botulinum su... | NM_009008.3 | 89% | 98.9% | (many diffs) |
7 | mouse | 170758 | Rac3 | RAS-related C3 botulinum su... | NM_133223.4 | 80.9% | 88.5% | (many diffs) |
8 | mouse | 19353 | Rac1 | RAS-related C3 botulinum su... | NM_009007.2 | 77.3% | 92.1% | (many diffs) |
9 | mouse | 19353 | Rac1 | RAS-related C3 botulinum su... | NM_001347530.1 | 70.5% | 83.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 642
- ORF length:
- 576
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca ggccatcaag tgtgtggtgg tgggagatgg ggccgtgggc aagacctgcc 121 ttctcatcag ctacaccacc aacgcgtttc ccggagagta catccccacc gtgtttgaca 181 actattcagc caatgtgatg gtggacagca agccagtgaa cctggggctg tgggacactg 241 ctgggcagga ggactacgac cgtctccggc cgctctccta tccacagacg gacgtcttcc 301 tcatctgctt ctccctcgtc agcccagcct cttatgagaa cgtccgcgcc aagtggttcc 361 cagaagtgcg gcaccactgc cccagcacac ccatcatccT GGTGGGCACC AAGCTGGACC 421 TGCGGGACGA CAAGGACACC ATCGAGAAAC TGAAGGAGAA GAAGCTGGCT CCCATCACCT 481 ACCCGCAGGG CCTGGCACTG GCCAAGGAGA TTGACTCGGT GAAATACCTG GAGTGCTCAG 541 CTCTCACCCA GAGAGGCCTG AAAACCGTGT TCGACGAGGC CATCCGGGCC GTGCTGTGCC 601 CTCAGCCCAC GCGGCAGCAG AAGCGCGCCT GCAGCCTCCT CTACCCAACT TTCTTGTACA 661 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 721 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 781 AGGACGATCC TGGTGCGGGT ACCTTCGAGC AACGCGTTAA GTCgacaatc aacctctgga 841 ttacaaaatt tgtgaaagat t