Transcript: Human NM_006908.5

Homo sapiens Rac family small GTPase 1 (RAC1), transcript variant Rac1, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
RAC1 (5879)
Length:
2309
CDS:
210..788

Additional Resources:

NCBI RefSeq record:
NM_006908.5
NBCI Gene record:
RAC1 (5879)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006908.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004873 CCCTACTGTCTTTGACAATTA pLKO.1 308 CDS 100% 13.200 9.240 N RAC1 n/a
2 TRCN0000318375 CCCTACTGTCTTTGACAATTA pLKO_005 308 CDS 100% 13.200 9.240 N RAC1 n/a
3 TRCN0000004871 CGCAAACAGATGTGTTCTTAA pLKO.1 427 CDS 100% 13.200 9.240 N RAC1 n/a
4 TRCN0000310890 ATGTCCGTGCAAAGTGGTATC pLKO_005 484 CDS 100% 6.000 4.200 N Rac1 n/a
5 TRCN0000004872 CGTGAAGAAGAGGAAGAGAAA pLKO.1 752 CDS 100% 4.950 3.465 N RAC1 n/a
6 TRCN0000318431 CGTGAAGAAGAGGAAGAGAAA pLKO_005 752 CDS 100% 4.950 3.465 N RAC1 n/a
7 TRCN0000004870 GCTAAGGAGATTGGTGCTGTA pLKO.1 645 CDS 100% 4.050 2.835 N RAC1 n/a
8 TRCN0000318430 GCTAAGGAGATTGGTGCTGTA pLKO_005 645 CDS 100% 4.050 2.835 N RAC1 n/a
9 TRCN0000055192 CCAATGTTATGGTAGATGGAA pLKO.1 334 CDS 100% 3.000 2.100 N Rac1 n/a
10 TRCN0000004869 CCTTCTTAACATCACTGTCTT pLKO.1 1975 3UTR 100% 4.950 2.970 N RAC1 n/a
11 TRCN0000318432 CCTTCTTAACATCACTGTCTT pLKO_005 1975 3UTR 100% 4.950 2.970 N RAC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006908.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15559 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15559 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_06831 pDONR223 100% 99.8% 99.4% None 404C>T n/a
4 ccsbBroad304_06831 pLX_304 98.4% 99.8% 99.4% V5 404C>T n/a
5 TRCN0000474978 TTAGGGTTTGTATCGAAATGACCC pLX_317 92.9% 99.8% 99.4% V5 404C>T n/a
6 ccsbBroadEn_06832 pDONR223 100% 75.9% 92.1% None (many diffs) n/a
7 ccsbBroad304_06832 pLX_304 0% 75.9% 92.1% V5 (many diffs) n/a
8 TRCN0000467053 TCCTGGTGCGGGTACCTTCGAGCA pLX_317 42.4% 75.9% 92.1% V5 (many diffs) n/a
9 ccsbBroadEn_06833 pDONR223 100% 75.8% 92.1% None (many diffs) n/a
10 ccsbBroad304_06833 pLX_304 0% 75.8% 92.1% V5 (many diffs) n/a
11 TRCN0000468968 GCGGTTAAACATGACAGCCCCCAT pLX_317 71.4% 75.8% 92.1% V5 (many diffs) n/a
Download CSV