Transcript: Mouse NM_133223.4

Mus musculus RAS-related C3 botulinum substrate 3 (Rac3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rac3 (170758)
Length:
1078
CDS:
140..718

Additional Resources:

NCBI RefSeq record:
NM_133223.4
NBCI Gene record:
Rac3 (170758)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_133223.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065393 CGTGATGACAAGGATACGATT pLKO.1 497 CDS 100% 4.950 3.960 N Rac3 n/a
2 TRCN0000065394 CTCTCCTATCCTCAAACAGAT pLKO.1 347 CDS 100% 4.950 3.960 N Rac3 n/a
3 TRCN0000065395 AGAGATTGGTTCCGTCAAGTA pLKO.1 580 CDS 100% 4.950 3.465 N Rac3 n/a
4 TRCN0000065396 AGGCAAGAAGTGCACTGTATT pLKO.1 694 CDS 100% 13.200 7.920 N Rac3 n/a
5 TRCN0000065397 TCAAACAGATGTCTTTCTGAT pLKO.1 358 CDS 100% 4.950 2.970 N Rac3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_133223.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06833 pDONR223 100% 89.2% 99.4% None (many diffs) n/a
2 ccsbBroad304_06833 pLX_304 0% 89.2% 99.4% V5 (many diffs) n/a
3 TRCN0000468968 GCGGTTAAACATGACAGCCCCCAT pLX_317 71.4% 89.2% 99.4% V5 (many diffs) n/a
4 ccsbBroadEn_06832 pDONR223 100% 80.9% 88.5% None (many diffs) n/a
5 ccsbBroad304_06832 pLX_304 0% 80.9% 88.5% V5 (many diffs) n/a
6 TRCN0000467053 TCCTGGTGCGGGTACCTTCGAGCA pLX_317 42.4% 80.9% 88.5% V5 (many diffs) n/a
Download CSV