Construct: ORF TRCN0000467082
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005714.1_s317c1
- Derived from:
- ccsbBroadEn_11087
- DNA Barcode:
- AAGGCTGCAACCCTGACGCTCCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RAD51C (5889)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467082
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5889 | RAD51C | RAD51 paralog C | NM_002876.3 | 99.2% | 99.2% | 403_405delTGG |
| 2 | human | 5889 | RAD51C | RAD51 paralog C | NR_103873.1 | 44.8% | 1_71del;112_113ins103;371_563del | |
| 3 | human | 5889 | RAD51C | RAD51 paralog C | XM_006722002.4 | 39.1% | 39.1% | 403_1026del |
| 4 | human | 5889 | RAD51C | RAD51 paralog C | NM_058216.3 | 35.6% | 35.6% | 403_1128del |
| 5 | human | 5889 | RAD51C | RAD51 paralog C | XM_006722001.4 | 35.5% | 35.5% | 403_1131del |
| 6 | human | 5889 | RAD51C | RAD51 paralog C | XR_934514.3 | 23.1% | 1_504del;907_1738del | |
| 7 | human | 5889 | RAD51C | RAD51 paralog C | XR_934513.3 | 21.2% | 1_504del;907_1889del | |
| 8 | human | 5889 | RAD51C | RAD51 paralog C | NR_103872.2 | 16.7% | 1_42del;445_2395del | |
| 9 | mouse | 114714 | Rad51c | RAD51 paralog C | XM_011248671.2 | 43.7% | 41.9% | (many diffs) |
| 10 | mouse | 114714 | Rad51c | RAD51 paralog C | NM_053269.3 | 29.7% | 28.5% | (many diffs) |
| 11 | mouse | 114714 | Rad51c | RAD51 paralog C | XM_006532009.3 | 28.7% | 26.4% | (many diffs) |
| 12 | mouse | 114714 | Rad51c | RAD51 paralog C | XR_388326.3 | 16.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 468
- ORF length:
- 402
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg cgggaagacg ttccgctttg aaatgcagcg ggatttggtg agtttcccgc 121 tgtctccagc ggtgcgggtg aagctggtgt ctgcggggtt ccagactgct gaggaactcc 181 tagaggtgaa accctccgag cttagcaaag aagttgggat atctaaagca gaagccttag 241 aaactctgca aattatcaga agagaatgtc tcacaaataa accaagatat gctggtacat 301 cTGAGTCACA CAAGAAGTGT ACAGCACTGG AACTTCTTGA GCAGGAGCAT ACCCAGGGCT 361 TCATAATCAC CTTCTGTTCA GCACTAGATG ATATTCTTGG GGGTGGAGTG CCCTTAATGA 421 AAACAACAGA AATTTGTGGT GCACCAGGTG TTGGAAAAAC ACAATTATGC CCAACTTTCT 481 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 541 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 601 GTGGAAAGGA CGAAAGGCTG CAACCCTGAC GCTCCCAACG CGTTAAGTCg acaatcaacc 661 tctggattac aaaatttgtg aaagatt