Transcript: Mouse XM_011248671.2

PREDICTED: Mus musculus RAD51 paralog C (Rad51c), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rad51c (114714)
Length:
857
CDS:
103..843

Additional Resources:

NCBI RefSeq record:
XM_011248671.2
NBCI Gene record:
Rad51c (114714)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011248671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071260 GCTAGTGATAATAGACGGAAT pLKO.1 802 CDS 100% 4.050 5.670 N Rad51c n/a
2 TRCN0000148215 GCAAAGAAGTTGGGATATCTA pLKO.1 215 CDS 100% 5.625 4.500 N RAD51C n/a
3 TRCN0000330118 GCAAAGAAGTTGGGATATCTA pLKO_005 215 CDS 100% 5.625 4.500 N RAD51C n/a
4 TRCN0000330045 AGCATACCCAGGGCTTCATAA pLKO_005 356 CDS 100% 13.200 9.240 N RAD51C n/a
5 TRCN0000147658 GCTTCATAATCACCTTCTGTT pLKO.1 368 CDS 100% 4.950 3.465 N RAD51C n/a
6 TRCN0000071261 CCAGGGCTTCATAATCACCTT pLKO.1 363 CDS 100% 2.640 1.848 N Rad51c n/a
7 TRCN0000335778 CCAGGGCTTCATAATCACCTT pLKO_005 363 CDS 100% 2.640 1.848 N Rad51c n/a
8 TRCN0000071262 GCTCAGCAAAGAAGTTGGGAT pLKO.1 210 CDS 100% 2.640 1.848 N Rad51c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011248671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11087 pDONR223 100% 43.7% 41.9% None (many diffs) n/a
2 ccsbBroad304_11087 pLX_304 0% 43.7% 41.9% V5 (many diffs) n/a
3 TRCN0000467082 AAGGCTGCAACCCTGACGCTCCCA pLX_317 41.9% 43.7% 41.9% V5 (many diffs) n/a
Download CSV