Construct: ORF TRCN0000467173
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014340.1_s317c1
- Derived from:
- ccsbBroadEn_12459
- DNA Barcode:
- ACACTATAAGAGCAACATAGCTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MMS19 (64210)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467173
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_017016534.2 | 47.6% | 47.7% | 1_963del;1326C>T |
2 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_017016535.2 | 47.6% | 47.7% | 1_963del;1326C>T |
3 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_011540063.3 | 47.5% | 47.6% | 1_966del;1329C>T |
4 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_017016533.2 | 44% | 44% | 1_1116del;1479C>T |
5 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_024448126.1 | 44% | 44% | 1_1116del;1479C>T |
6 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | NM_001351358.1 | 43.9% | 43.9% | 1_1119del;1482C>T |
7 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | NM_001351359.1 | 43.9% | 43.9% | 1_1119del;1482C>T |
8 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_006717945.3 | 43.9% | 43.9% | 1_1119del;1482C>T |
9 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_017016527.2 | 43.9% | 43.9% | 1_1119del;1482C>T |
10 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_017016529.2 | 43.9% | 43.9% | 1_1119del;1482C>T |
11 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_017016531.1 | 43.9% | 43.9% | 1_1119del;1482C>T |
12 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_024448123.1 | 43.9% | 43.9% | 1_1119del;1482C>T |
13 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_024448124.1 | 43.9% | 43.9% | 1_1119del;1482C>T |
14 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_024448125.1 | 43.9% | 43.9% | 1_1119del;1482C>T |
15 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_005270041.1 | 35.3% | 35.3% | 1_1608del;1971C>T |
16 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_011540062.1 | 35.3% | 35.3% | 1_1608del;1971C>T |
17 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | NM_001289404.1 | 33.6% | 33.6% | 1_1734del;2097C>T |
18 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_017016524.2 | 33.6% | 33.6% | 1_1734del;2097C>T |
19 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | NM_001351357.1 | 33.5% | 33.6% | 1_1737del;2100C>T |
20 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_005270035.3 | 33.5% | 33.6% | 1_1737del;2100C>T |
21 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_017016522.1 | 33.5% | 33.6% | 1_1737del;2100C>T |
22 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_017016521.2 | 31.4% | 31.4% | 1_1914del;2277C>T |
23 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | NM_001330128.1 | 31.4% | 31.4% | 1_1917del;2280C>T |
24 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_017016519.2 | 30.1% | 30.1% | 1_2034del;2397C>T |
25 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_017016518.2 | 29.6% | 29.7% | 1_2079del;2442C>T |
26 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | NM_001289403.1 | 29.6% | 29.6% | 1_2082del;2445C>T |
27 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_017016517.2 | 28.5% | 28.5% | 1_2199del;2562C>T |
28 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_006717944.4 | 28.4% | 28.4% | 1_2208del;2571C>T |
29 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | NM_001289405.1 | 28.4% | 28.4% | 1_2211del;2574C>T |
30 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | NM_022362.5 | 28.4% | 28.4% | 1_2211del;2574C>T |
31 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XM_017016516.2 | 27.4% | 27.4% | 1_2325del;2688C>T |
32 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | NM_001351356.1 | 27.3% | 27.4% | 1_2328del;2691C>T |
33 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XR_002957006.1 | 25.8% | (many diffs) | |
34 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XR_001747180.2 | 25.6% | (many diffs) | |
35 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XR_001747179.2 | 24.8% | (many diffs) | |
36 | human | 64210 | MMS19 | MMS19 homolog, cytosolic ir... | XR_001747178.2 | 24.7% | (many diffs) | |
37 | mouse | 72199 | Mms19 | MMS19 (MET18 S. cerevisiae) | XM_011247354.2 | 37.6% | 40.6% | (many diffs) |
38 | mouse | 72199 | Mms19 | MMS19 (MET18 S. cerevisiae) | XM_017318295.1 | 37.6% | 40.6% | (many diffs) |
39 | mouse | 72199 | Mms19 | MMS19 (MET18 S. cerevisiae) | XM_011247352.2 | 37.5% | 40.5% | (many diffs) |
40 | mouse | 72199 | Mms19 | MMS19 (MET18 S. cerevisiae) | XM_011247353.2 | 37.5% | 40.5% | (many diffs) |
41 | mouse | 72199 | Mms19 | MMS19 (MET18 S. cerevisiae) | XM_017318293.1 | 37.5% | 40.5% | (many diffs) |
42 | mouse | 72199 | Mms19 | MMS19 (MET18 S. cerevisiae) | XM_017318294.1 | 37.5% | 40.5% | (many diffs) |
43 | mouse | 72199 | Mms19 | MMS19 (MET18 S. cerevisiae) | XM_011247350.2 | 28.5% | 30.7% | (many diffs) |
44 | mouse | 72199 | Mms19 | MMS19 (MET18 S. cerevisiae) | XM_006527358.3 | 24.2% | 26.2% | (many diffs) |
45 | mouse | 72199 | Mms19 | MMS19 (MET18 S. cerevisiae) | NM_028152.3 | 24.2% | 26.1% | (many diffs) |
46 | mouse | 72199 | Mms19 | MMS19 (MET18 S. cerevisiae) | XR_001782619.1 | 21.3% | (many diffs) | |
47 | mouse | 72199 | Mms19 | MMS19 (MET18 S. cerevisiae) | XR_001782618.1 | 21.3% | (many diffs) | |
48 | mouse | 72199 | Mms19 | MMS19 (MET18 S. cerevisiae) | XR_001782617.1 | 19.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 945
- ORF length:
- 879
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg ggagcttttg gaactgagct gctgccacag ctgccccttt tcttccaccg 121 ctgctgccaa gtgctttgca ggactcctca acaagcaccc tgcagggcag cagctggatg 181 aattcctaca gctagctgtg gacaaagtgg aggctggcct gggctctggg ccctgtcgta 241 gtcaggcctt cactcttctt ctctgggtaa caaaggccct agtgctcaga taccatcctc 301 tcagctcctg ccttacagcc cggctcatgg gcctcctgag tgacccagaa ttaggtccag 361 cagcagctga tggcttctct ctgctcatgt ctgactgcac tgatgtgctg actcgtgctg 421 gccatgctga agtgcggatc atgttccgcc agcggttctt cacagataat gtgcctgctt 481 tggtccaggg cttccatgct gctccccaag atgtgaagcc aaactacttg aagggtcttt 541 ctcatgtact taacaggctg cccaagcctg tactcttgcc agagctgccc acgcttcttt 601 ccttgctgct ggaggccctg tcctgccctg actgtgtggt gcagctctcc acccTCAGCT 661 GCCTTCAGCC TCTTCTACTG GAAGCACCCC AAGTCATGAG TCTTCACGTG GACACCCTCG 721 TCACCAAGTT TCTGAACCTC AGCTCTAGCC CTTCCATGGC TGTCCGGATC GCCGCACTGC 781 AGTGCATGCA TGCTCTCACT CGCCTGCCCA CCCCTGTGCT GCTGCCGTAC AAACCACAGG 841 TGATTCGGGC CTTAGCCAAA CCCCTGGATG ACAAGAAGAG ACTGGTGCGC AAGGAAGCAG 901 TGTCAGCCAG AGGGGAGTGG TTTCTGTTGG GGAGCCCTGG CAGCTGCCCA ACCTTCTTGT 961 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1021 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1081 GAAAGGACGA ACACTATAAG AGCAACATAG CTTCACGCGT TAAGTCgaca atcaacctct 1141 ggattacaaa atttgtgaaa gatt