Transcript: Human XM_017016529.2

PREDICTED: Homo sapiens MMS19 homolog, cytosolic iron-sulfur assembly component (MMS19), transcript variant X19, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MMS19 (64210)
Length:
4083
CDS:
1715..3715

Additional Resources:

NCBI RefSeq record:
XM_017016529.2
NBCI Gene record:
MMS19 (64210)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422637 GCACAATCCAGTGACGTTATT pLKO_005 2390 CDS 100% 13.200 18.480 N MMS19 n/a
2 TRCN0000437113 GCGGCTGATTGCACTGCTTAT pLKO_005 2758 CDS 100% 10.800 15.120 N MMS19 n/a
3 TRCN0000420900 AGAACATAAGAGTCCATATTT pLKO_005 3868 3UTR 100% 15.000 10.500 N MMS19 n/a
4 TRCN0000107925 CCTGGGTCTCTTGCATTTATA pLKO.1 3949 3UTR 100% 15.000 10.500 N MMS19 n/a
5 TRCN0000107926 CCAGCGGTTCTTCACAGATAA pLKO.1 3217 CDS 100% 13.200 9.240 N MMS19 n/a
6 TRCN0000107928 CCGACACACAGTCTACAATAT pLKO.1 568 5UTR 100% 13.200 9.240 N MMS19 n/a
7 TRCN0000107927 CCTGCCTCGAAATGTGGAAAT pLKO.1 2794 CDS 100% 10.800 7.560 N MMS19 n/a
8 TRCN0000412995 CTGTTATTTCCCTATCGATTT pLKO_005 1257 5UTR 100% 10.800 7.560 N MMS19 n/a
9 TRCN0000107929 TGGAGCTATGAAGACAAAGAT pLKO.1 1901 CDS 100% 5.625 3.938 N MMS19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016529.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12459 pDONR223 100% 43.9% 43.9% None 1_1119del;1482C>T n/a
2 ccsbBroad304_12459 pLX_304 0% 43.9% 43.9% V5 1_1119del;1482C>T n/a
3 TRCN0000467173 ACACTATAAGAGCAACATAGCTTC pLX_317 33.4% 43.9% 43.9% V5 1_1119del;1482C>T n/a
Download CSV