Transcript: Mouse XM_017318294.1

PREDICTED: Mus musculus MMS19 (MET18 S. cerevisiae) (Mms19), transcript variant X13, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mms19 (72199)
Length:
3806
CDS:
1122..3122

Additional Resources:

NCBI RefSeq record:
XM_017318294.1
NBCI Gene record:
Mms19 (72199)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318294.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096385 GCGTCGGACAATCCTTGAAAT pLKO.1 1256 CDS 100% 13.200 18.480 N Mms19 n/a
2 TRCN0000323729 GCGTCGGACAATCCTTGAAAT pLKO_005 1256 CDS 100% 13.200 18.480 N Mms19 n/a
3 TRCN0000311372 ATGTGAAGTCCGGTGGCTATA pLKO_005 163 5UTR 100% 10.800 15.120 N Mms19 n/a
4 TRCN0000311374 CCTCCGCCTAACGATCCTTAT pLKO_005 688 5UTR 100% 10.800 8.640 N Mms19 n/a
5 TRCN0000096384 CCAGAGAATAAAGCCTTCTTT pLKO.1 3444 3UTR 100% 5.625 4.500 N Mms19 n/a
6 TRCN0000323731 CCAGAGAATAAAGCCTTCTTT pLKO_005 3444 3UTR 100% 5.625 4.500 N Mms19 n/a
7 TRCN0000096388 CCCTGAGAGCTACTGGTATTT pLKO.1 1865 CDS 100% 13.200 9.240 N Mms19 n/a
8 TRCN0000323730 CCCTGAGAGCTACTGGTATTT pLKO_005 1865 CDS 100% 13.200 9.240 N Mms19 n/a
9 TRCN0000096387 CCTGCCACGAAATGTGGAAAT pLKO.1 2201 CDS 100% 10.800 7.560 N Mms19 n/a
10 TRCN0000096386 GCCATACAAATCTCAGGTCAT pLKO.1 2999 CDS 100% 4.050 2.835 N Mms19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318294.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12459 pDONR223 100% 37.5% 40.5% None (many diffs) n/a
2 ccsbBroad304_12459 pLX_304 0% 37.5% 40.5% V5 (many diffs) n/a
3 TRCN0000467173 ACACTATAAGAGCAACATAGCTTC pLX_317 33.4% 37.5% 40.5% V5 (many diffs) n/a
Download CSV