Construct: ORF TRCN0000467174
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004247.1_s317c1
- Derived from:
- ccsbBroadEn_07963
- DNA Barcode:
- AGGCTCACCGTTGGTGCGTTGACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ANAPC15 (25906)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467174
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 25906 | ANAPC15 | anaphase promoting complex ... | NM_001278487.2 | 99.7% | 100% | 174C>T |
| 2 | human | 25906 | ANAPC15 | anaphase promoting complex ... | NM_001278488.1 | 99.7% | 100% | 174C>T |
| 3 | human | 25906 | ANAPC15 | anaphase promoting complex ... | NM_001278489.2 | 99.7% | 100% | 174C>T |
| 4 | human | 25906 | ANAPC15 | anaphase promoting complex ... | NM_001278490.2 | 99.7% | 100% | 174C>T |
| 5 | human | 25906 | ANAPC15 | anaphase promoting complex ... | NM_001278491.1 | 99.7% | 100% | 174C>T |
| 6 | human | 25906 | ANAPC15 | anaphase promoting complex ... | NM_001278492.1 | 99.7% | 100% | 174C>T |
| 7 | human | 25906 | ANAPC15 | anaphase promoting complex ... | NM_001278493.1 | 99.7% | 100% | 174C>T |
| 8 | human | 25906 | ANAPC15 | anaphase promoting complex ... | NM_001278494.1 | 99.7% | 100% | 174C>T |
| 9 | human | 25906 | ANAPC15 | anaphase promoting complex ... | NM_014042.3 | 99.7% | 100% | 174C>T |
| 10 | human | 25906 | ANAPC15 | anaphase promoting complex ... | XM_017017496.1 | 99.7% | 100% | 174C>T |
| 11 | human | 25906 | ANAPC15 | anaphase promoting complex ... | XM_017017497.1 | 99.7% | 100% | 174C>T |
| 12 | human | 25906 | ANAPC15 | anaphase promoting complex ... | NM_001278485.2 | 96.5% | 96.8% | 174C>T;317_328del |
| 13 | human | 25906 | ANAPC15 | anaphase promoting complex ... | NM_001278486.2 | 96.5% | 96.8% | 174C>T;317_328del |
| 14 | human | 25906 | ANAPC15 | anaphase promoting complex ... | NM_001330321.2 | 58.4% | 53.7% | (many diffs) |
| 15 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | NM_001291349.1 | 93.9% | 100% | (many diffs) |
| 16 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | XM_011241935.2 | 93.9% | 100% | (many diffs) |
| 17 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | NM_001291352.1 | 86.1% | 91.6% | (many diffs) |
| 18 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | NM_001291353.1 | 86.1% | 91.6% | (many diffs) |
| 19 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | NM_027532.4 | 86.1% | 91.6% | (many diffs) |
| 20 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | XM_017312359.1 | 86.1% | 91.6% | (many diffs) |
| 21 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | NM_001291348.1 | 80.6% | 85.8% | (many diffs) |
| 22 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | XM_006508282.3 | 74% | 71.2% | (many diffs) |
| 23 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | XM_006508284.3 | 74% | 71.2% | (many diffs) |
| 24 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | XM_006508285.3 | 74% | 71.2% | (many diffs) |
| 25 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | XM_017312358.1 | 74% | 71.2% | (many diffs) |
| 26 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | XM_006508279.2 | 68.9% | 66.4% | (many diffs) |
| 27 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | XM_006508280.3 | 68.9% | 66.4% | (many diffs) |
| 28 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | XM_011241930.1 | 68.9% | 66.4% | (many diffs) |
| 29 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | XM_011241931.2 | 68.9% | 66.4% | (many diffs) |
| 30 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | XM_011241932.1 | 68.9% | 66.4% | (many diffs) |
| 31 | mouse | 75430 | Anapc15 | anaphase prompoting complex... | XM_011241933.1 | 68.9% | 66.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 429
- ORF length:
- 363
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc cactttgttc ccctcactct tccctcgtgt gactgagact ctgtggtttA 121 ATCTGGATCG ACCCTGTGTG GAAGAGACAG AGCTGCAGCA GCAGGAACAG CAGCATCAGG 181 CCTGGCTCCA AAGCATCGCG GAGAAAGACA ACAACCTGGT TCCTATTGGC AAGCCAGCTT 241 CAGAGCACTA TGATGACGAG GAAGAAGAGG ATGATGAAGA TGATGAGGAT AGTGAAGAGG 301 ACTCAGAGGA TGATGAGGAT ATGCAGGACA TGGACGAGAT GAATGACTAC AATGAGTCAC 361 CGGATGATGG AGAGGTCAAT GAGGTGGACA TGGAAGGCAA CGAACAGGAT CAGGACCAGT 421 GGATGATCTA CCCAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 481 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 541 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGAAGGCTC ACCGTTGGTG CGTTGACAAC 601 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt