Transcript: Mouse NM_001291348.1

Mus musculus anaphase prompoting complex C subunit 15 (Anapc15), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Anapc15 (75430)
Length:
850
CDS:
121..546

Additional Resources:

NCBI RefSeq record:
NM_001291348.1
NBCI Gene record:
Anapc15 (75430)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000181918 CATCGCAGAGAAAGACAACAA pLKO.1 309 CDS 100% 4.950 3.465 N Anapc15 n/a
2 TRCN0000292794 CATCGCAGAGAAAGACAACAA pLKO_005 309 CDS 100% 4.950 3.465 N Anapc15 n/a
3 TRCN0000181534 GCAAGACATGGATGAGATGAA pLKO.1 438 CDS 100% 4.950 3.465 N Anapc15 n/a
4 TRCN0000292850 GCAAGACATGGATGAGATGAA pLKO_005 438 CDS 100% 4.950 3.465 N Anapc15 n/a
5 TRCN0000182466 GCTTTCCCTTAGGCACTTTCT pLKO.1 656 3UTR 100% 4.950 3.465 N Anapc15 n/a
6 TRCN0000292793 GCTTTCCCTTAGGCACTTTCT pLKO_005 656 3UTR 100% 4.950 3.465 N Anapc15 n/a
7 TRCN0000177202 GACTATAATGAGTCACCTGAT pLKO.1 460 CDS 100% 4.050 2.835 N Anapc15 n/a
8 TRCN0000292851 GACTATAATGAGTCACCTGAT pLKO_005 460 CDS 100% 4.050 2.835 N Anapc15 n/a
9 TRCN0000181627 GAAGATGATGAGGACATGCAA pLKO.1 421 CDS 100% 3.000 2.100 N Anapc15 n/a
10 TRCN0000182465 GACAGTGAAGAGGATTCCGAA pLKO.1 403 CDS 100% 2.640 1.848 N Anapc15 n/a
11 TRCN0000181505 GAGAAAGACAACAACCTGGTA pLKO.1 316 CDS 100% 2.640 1.848 N Anapc15 n/a
12 TRCN0000144934 GAAGAGGATGATGAAGATGAT pLKO.1 379 CDS 100% 4.950 2.475 Y ANAPC15 n/a
13 TRCN0000344368 GAAGAGGATGATGAAGATGAT pLKO_005 379 CDS 100% 4.950 2.475 Y ANAPC15 n/a
14 TRCN0000143366 GAGAAAGACAACAACCTGGTT pLKO.1 316 CDS 100% 2.640 1.848 N ANAPC15 n/a
15 TRCN0000344428 GAGAAAGACAACAACCTGGTT pLKO_005 316 CDS 100% 2.640 1.848 N ANAPC15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02882 pDONR223 100% 80.8% 85.8% None (many diffs) n/a
2 ccsbBroad304_02882 pLX_304 0% 80.8% 85.8% V5 (many diffs) n/a
3 TRCN0000475223 CAATCCACTCCAGTTATACAATTA pLX_317 91.1% 80.8% 85.8% V5 (many diffs) n/a
4 ccsbBroadEn_07963 pDONR223 100% 80.6% 85.8% None (many diffs) n/a
5 ccsbBroad304_07963 pLX_304 0% 80.6% 85.8% V5 (many diffs) n/a
6 TRCN0000467174 AGGCTCACCGTTGGTGCGTTGACA pLX_317 83.5% 80.6% 85.8% V5 (many diffs) n/a
Download CSV