Transcript: Mouse XM_011242677.2

PREDICTED: Mus musculus proline-serine-threonine phosphatase-interacting protein 1 (Pstpip1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pstpip1 (19200)
Length:
1399
CDS:
17..1231

Additional Resources:

NCBI RefSeq record:
XM_011242677.2
NBCI Gene record:
Pstpip1 (19200)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093293 CGGTGCCTTATCAGAACTACT pLKO.1 825 CDS 100% 4.950 6.930 N Pstpip1 n/a
2 TRCN0000093292 TCCGGTGCCTTATCAGAACTA pLKO.1 823 CDS 100% 4.950 6.930 N Pstpip1 n/a
3 TRCN0000093289 CCCAGGGAAACCTTAACTCAT pLKO.1 1038 CDS 100% 4.950 3.465 N Pstpip1 n/a
4 TRCN0000093290 GAAGAGCAAGTTGTCGCTCTA pLKO.1 364 CDS 100% 0.405 0.284 N Pstpip1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242677.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07348 pDONR223 100% 82.9% 85.3% None (many diffs) n/a
2 ccsbBroad304_07348 pLX_304 0% 82.9% 85.3% V5 (many diffs) n/a
3 TRCN0000467183 ACACGATCCGCGTCCTTACAATAC pLX_317 13.2% 82.9% 85.3% V5 (many diffs) n/a
Download CSV