Construct: ORF TRCN0000467512
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004279.1_s317c1
- Derived from:
- ccsbBroadEn_05255
- DNA Barcode:
- CACGTAAACACACCTGGCACATAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OPN5 (221391)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467512
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 221391 | OPN5 | opsin 5 | NM_181744.3 | 100% | 100% | |
| 2 | human | 221391 | OPN5 | opsin 5 | XM_017010416.1 | 86.6% | 86.5% | 1057_1062delGACAAAinsT;1067_1224delinsA |
| 3 | human | 221391 | OPN5 | opsin 5 | XM_017010411.1 | 84.1% | 84.1% | 0_1ins168 |
| 4 | human | 221391 | OPN5 | opsin 5 | XM_017010410.1 | 59.8% | 59.8% | (many diffs) |
| 5 | human | 221391 | OPN5 | opsin 5 | XM_017010409.1 | 57.6% | 55.3% | (many diffs) |
| 6 | human | 221391 | OPN5 | opsin 5 | XM_017010412.1 | 56.4% | 56.3% | 0_1ins369;688_693delGACAAAinsT;698_855delinsA |
| 7 | human | 221391 | OPN5 | opsin 5 | XM_017010413.1 | 56.4% | 56.3% | 0_1ins369;688_693delGACAAAinsT;698_855delinsA |
| 8 | human | 221391 | OPN5 | opsin 5 | XM_017010415.1 | 46.1% | 46% | 0_1ins495;562_567delGACAAAinsT;572_729delinsA |
| 9 | human | 221391 | OPN5 | opsin 5 | XM_017010414.1 | 44.7% | 42.4% | (many diffs) |
| 10 | human | 221391 | OPN5 | opsin 5 | NR_033806.2 | 25.6% | (many diffs) | |
| 11 | mouse | 353344 | Opn5 | opsin 5 | NM_181753.4 | 83.8% | 89.3% | (many diffs) |
| 12 | mouse | 353344 | Opn5 | opsin 5 | XM_006524453.1 | 74.1% | 78.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1131
- ORF length:
- 1062
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcgttaaat cacactgccc tgcctcagga cgagcgcctg ccccattacc 121 ttcgagatgg ggatcctttt gcttccaaac tttcttggga agcggattta gtggctggct 181 tttacctaac aataattggg attctgtcca catttggaaa tggatatgtc ctttacatgt 241 cttctagacg aaagaagaag ctgagacccg ctgaaataat gactatcaat ttagcagtct 301 gtgatctggg gatttcagtt gtaggcaagc cgttcaccat catctcttgc ttttgtcacc 361 gctgggtgtt tggctggatc ggctgccgct ggtatggatg ggctggattt ttctttggct 421 gtggaagcct tatcaccatg actgctgtca gcctggatcg atatttgaaa atctgctatt 481 tatcttatgg ggtttggctg aaaagaaagc acgcctacat ctgcctggca gccatctggg 541 cctatgcttc cttctggacc accatgccct tggtaggtct gggggactac gtacctgagc 601 ccttcggaac ctcgtgcacc ctggactggt ggctggccca ggcctcggta gggggccagg 661 ttttcatcct gaacatcctc ttcttctgcc tcttgctccc aacggctgtg atcgtgttct 721 cctacgtaaa gatcattgcc aaggttaagt cctcttccaa agaagtagct catttcgaca 781 gtcggatcca tagcagccat gtgctggaaa tgaaactgac aaaggtagcg atgttgattt 841 gtgctggatt cctgattgcc tggattcctt atgcagtggt gtctgtgtgg tcagcttttG 901 GAAGGCCAGA CTCCATTCCC ATACAGCTCT CTGTGGTGCC AACCCTACTT GCAAAATCTG 961 CAGCGATGTA CAATCCCATC ATTTACCAAG TTATTGATTA CAAATTTGCC TGTTGCCAAA 1021 CTGGTGGTTT GAAAGCAACC AAGAAGAAGT CTCTGGAAGG CTTCAGGCTG CACACCGTAA 1081 CCACAGTCAG GAAGTCTTCT GCTGTGCTGG AAATTCATGA AGAGTGGGAA TTGCCAACTT 1141 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1201 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1261 CTTGTGGAAA GGACGACACG TAAACACACC TGGCACATAG ACGCGTTAAG TCgacaatca 1321 acctctggat tacaaaattt gtgaaagatt