Transcript: Human NR_033806.2

Homo sapiens opsin 5 (OPN5), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
OPN5 (221391)
Length:
3500
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_033806.2
NBCI Gene record:
OPN5 (221391)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_033806.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358314 TGTCAGCCTGGATCGATATTT pLKO_005 343 3UTR 100% 15.000 21.000 N OPN5 n/a
2 TRCN0000358317 GATCGTGTTCTCCTACGTAAA pLKO_005 687 3UTR 100% 10.800 15.120 N OPN5 n/a
3 TRCN0000358316 TGCCAGAAACCCACGCTTTAA pLKO_005 1343 3UTR 100% 13.200 10.560 N OPN5 n/a
4 TRCN0000358315 CCCATCATTTACCAAGTTATT pLKO_005 952 3UTR 100% 13.200 9.240 N OPN5 n/a
5 TRCN0000014408 GCAGAGAAATTAGCTTACAAA pLKO.1 1167 3UTR 100% 5.625 3.938 N OPN5 n/a
6 TRCN0000014411 CTTCCAAAGAAGTAGCTCATT pLKO.1 731 3UTR 100% 4.950 3.465 N OPN5 n/a
7 TRCN0000026854 GTTCACCATCATCTCTTGCTT pLKO.1 229 3UTR 100% 3.000 2.100 N Opn5 n/a
8 TRCN0000014410 GCTGGAAATGAAACTGACAAA pLKO.1 780 3UTR 100% 4.950 2.970 N OPN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_033806.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05255 pDONR223 100% 25.6% None (many diffs) n/a
2 ccsbBroad304_05255 pLX_304 0% 25.6% V5 (many diffs) n/a
3 TRCN0000467512 CACGTAAACACACCTGGCACATAG pLX_317 22.3% 25.6% V5 (many diffs) n/a
4 TRCN0000489045 TATGCACCCAAGCTGCTGGCAGGT pLX_317 35.4% 25.6% V5 (many diffs) n/a
5 TRCN0000489186 TCCCACCTGGCTCAATCGAAGTGC pLX_317 34% 25.6% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_14439 pDONR223 100% 16.1% None 1_540del;641T>C;1108_3500del n/a
7 ccsbBroad304_14439 pLX_304 0% 16.1% V5 1_540del;641T>C;1108_3500del n/a
8 TRCN0000467751 CACCAGGAAGTGCCCACGCTTTCA pLX_317 65.9% 16.1% V5 1_540del;641T>C;1108_3500del n/a
Download CSV