Transcript: Mouse NM_181753.4

Mus musculus opsin 5 (Opn5), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Opn5 (353344)
Length:
1824
CDS:
5..1138

Additional Resources:

NCBI RefSeq record:
NM_181753.4
NBCI Gene record:
Opn5 (353344)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181753.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220289 CGCTATCTGAAGATCTGTTAT pLKO.1 395 CDS 100% 13.200 18.480 N Opn5 n/a
2 TRCN0000014412 GCGGATTTAGTGGCTGGCTTT pLKO.1 98 CDS 100% 4.050 5.670 N OPN5 n/a
3 TRCN0000220290 GCGGAAATAATGACTATCAAT pLKO.1 206 CDS 100% 5.625 3.938 N Opn5 n/a
4 TRCN0000026854 GTTCACCATCATCTCTTGCTT pLKO.1 268 CDS 100% 3.000 2.100 N Opn5 n/a
5 TRCN0000220291 TCTTCTAAAGAGGTAGCCCAT pLKO.1 689 CDS 100% 2.160 1.512 N Opn5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181753.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05255 pDONR223 100% 83.8% 89.3% None (many diffs) n/a
2 ccsbBroad304_05255 pLX_304 0% 83.8% 89.3% V5 (many diffs) n/a
3 TRCN0000467512 CACGTAAACACACCTGGCACATAG pLX_317 22.3% 83.8% 89.3% V5 (many diffs) n/a
4 TRCN0000489045 TATGCACCCAAGCTGCTGGCAGGT pLX_317 35.4% 83.8% 89.3% V5 (many diffs) n/a
5 TRCN0000489186 TCCCACCTGGCTCAATCGAAGTGC pLX_317 34% 83.8% 89.3% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_14439 pDONR223 100% 43.6% 46.1% None (many diffs) n/a
7 ccsbBroad304_14439 pLX_304 0% 43.6% 46.1% V5 (many diffs) n/a
8 TRCN0000467751 CACCAGGAAGTGCCCACGCTTTCA pLX_317 65.9% 43.6% 46.1% V5 (many diffs) n/a
Download CSV