Transcript: Mouse XM_006524453.1

PREDICTED: Mus musculus opsin 5 (Opn5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Opn5 (353344)
Length:
1861
CDS:
152..1171

Additional Resources:

NCBI RefSeq record:
XM_006524453.1
NBCI Gene record:
Opn5 (353344)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006524453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220289 CGCTATCTGAAGATCTGTTAT pLKO.1 428 CDS 100% 13.200 18.480 N Opn5 n/a
2 TRCN0000014412 GCGGATTTAGTGGCTGGCTTT pLKO.1 43 5UTR 100% 4.050 5.670 N OPN5 n/a
3 TRCN0000220290 GCGGAAATAATGACTATCAAT pLKO.1 239 CDS 100% 5.625 3.938 N Opn5 n/a
4 TRCN0000026854 GTTCACCATCATCTCTTGCTT pLKO.1 301 CDS 100% 3.000 2.100 N Opn5 n/a
5 TRCN0000220291 TCTTCTAAAGAGGTAGCCCAT pLKO.1 722 CDS 100% 2.160 1.512 N Opn5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006524453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05255 pDONR223 100% 74.1% 78.2% None (many diffs) n/a
2 ccsbBroad304_05255 pLX_304 0% 74.1% 78.2% V5 (many diffs) n/a
3 TRCN0000467512 CACGTAAACACACCTGGCACATAG pLX_317 22.3% 74.1% 78.2% V5 (many diffs) n/a
4 TRCN0000489045 TATGCACCCAAGCTGCTGGCAGGT pLX_317 35.4% 74.1% 78.2% V5 (many diffs) n/a
5 TRCN0000489186 TCCCACCTGGCTCAATCGAAGTGC pLX_317 34% 74.1% 78.2% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_14439 pDONR223 100% 48.4% 51.3% None (many diffs) n/a
7 ccsbBroad304_14439 pLX_304 0% 48.4% 51.3% V5 (many diffs) n/a
8 TRCN0000467751 CACCAGGAAGTGCCCACGCTTTCA pLX_317 65.9% 48.4% 51.3% V5 (many diffs) n/a
Download CSV