Transcript: Human XM_017010412.1

PREDICTED: Homo sapiens opsin 5 (OPN5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OPN5 (221391)
Length:
8485
CDS:
562..1419

Additional Resources:

NCBI RefSeq record:
XM_017010412.1
NBCI Gene record:
OPN5 (221391)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010412.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358314 TGTCAGCCTGGATCGATATTT pLKO_005 570 CDS 100% 15.000 21.000 N OPN5 n/a
2 TRCN0000358317 GATCGTGTTCTCCTACGTAAA pLKO_005 834 CDS 100% 10.800 15.120 N OPN5 n/a
3 TRCN0000358316 TGCCAGAAACCCACGCTTTAA pLKO_005 1621 3UTR 100% 13.200 10.560 N OPN5 n/a
4 TRCN0000358315 CCCATCATTTACCAAGTTATT pLKO_005 1099 CDS 100% 13.200 9.240 N OPN5 n/a
5 TRCN0000014408 GCAGAGAAATTAGCTTACAAA pLKO.1 1445 3UTR 100% 5.625 3.938 N OPN5 n/a
6 TRCN0000014411 CTTCCAAAGAAGTAGCTCATT pLKO.1 878 CDS 100% 4.950 3.465 N OPN5 n/a
7 TRCN0000026854 GTTCACCATCATCTCTTGCTT pLKO.1 456 5UTR 100% 3.000 2.100 N Opn5 n/a
8 TRCN0000014410 GCTGGAAATGAAACTGACAAA pLKO.1 927 CDS 100% 4.950 2.970 N OPN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010412.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14439 pDONR223 100% 65.9% 65.6% None (many diffs) n/a
2 ccsbBroad304_14439 pLX_304 0% 65.9% 65.6% V5 (many diffs) n/a
3 TRCN0000467751 CACCAGGAAGTGCCCACGCTTTCA pLX_317 65.9% 65.9% 65.6% V5 (many diffs) n/a
4 ccsbBroadEn_05255 pDONR223 100% 56.4% 56.3% None 0_1ins369;688_693delGACAAAinsT;698_855delinsA n/a
5 ccsbBroad304_05255 pLX_304 0% 56.4% 56.3% V5 0_1ins369;688_693delGACAAAinsT;698_855delinsA n/a
6 TRCN0000467512 CACGTAAACACACCTGGCACATAG pLX_317 22.3% 56.4% 56.3% V5 0_1ins369;688_693delGACAAAinsT;698_855delinsA n/a
7 TRCN0000489045 TATGCACCCAAGCTGCTGGCAGGT pLX_317 35.4% 56.4% 56.3% V5 0_1ins369;688_693delGACAAAinsT;698_855delinsA n/a
8 TRCN0000489186 TCCCACCTGGCTCAATCGAAGTGC pLX_317 34% 56.4% 56.3% V5 (not translated due to prior stop codon) 0_1ins369;688_693delGACAAAinsT;698_855delinsA n/a
Download CSV