Construct: ORF TRCN0000467519
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008239.1_s317c1
- Derived from:
- ccsbBroadEn_10873
- DNA Barcode:
- TAGATAGCAAGTTGAAAACATAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HLA-A (3105)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467519
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3105 | HLA-A | major histocompatibility co... | NM_002116.8 | 95.7% | 91.2% | (many diffs) |
| 2 | human | 3105 | HLA-A | major histocompatibility co... | NM_001242758.1 | 95.7% | 90.6% | (many diffs) |
| 3 | human | 3106 | HLA-B | major histocompatibility co... | NM_005514.8 | 89.6% | 83.8% | (many diffs) |
| 4 | human | 3107 | HLA-C | major histocompatibility co... | NM_002117.6 | 88.3% | 80.6% | (many diffs) |
| 5 | human | 3107 | HLA-C | major histocompatibility co... | NM_001243042.1 | 88.3% | 81.1% | (many diffs) |
| 6 | human | 3133 | HLA-E | major histocompatibility co... | NM_005516.6 | 85.6% | 74% | (many diffs) |
| 7 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010809.2 | 83.7% | 72.6% | (many diffs) |
| 8 | human | 3135 | HLA-G | major histocompatibility co... | NM_002127.5 | 82.1% | 72.8% | (many diffs) |
| 9 | human | 3135 | HLA-G | major histocompatibility co... | XM_024446420.1 | 82.1% | 72.8% | (many diffs) |
| 10 | human | 3134 | HLA-F | major histocompatibility co... | NM_018950.2 | 81.7% | 74.2% | (many diffs) |
| 11 | human | 3135 | HLA-G | major histocompatibility co... | NM_001363567.1 | 81% | 71.8% | (many diffs) |
| 12 | human | 3134 | HLA-F | major histocompatibility co... | XM_011514564.1 | 80.4% | 72% | (many diffs) |
| 13 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010813.1 | 79.6% | 70.5% | (many diffs) |
| 14 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010807.1 | 76.1% | 61.4% | (many diffs) |
| 15 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010808.1 | 76.1% | 61.4% | (many diffs) |
| 16 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010812.1 | 73.7% | 65.2% | (many diffs) |
| 17 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010810.1 | 71.3% | 63% | (many diffs) |
| 18 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098479.2 | 70.1% | 62% | (many diffs) |
| 19 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010811.1 | 69.6% | 60.4% | (many diffs) |
| 20 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010817.1 | 60.4% | 53.4% | (many diffs) |
| 21 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010818.1 | 60.4% | 53.4% | (many diffs) |
| 22 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098478.2 | 59.7% | 52.6% | (many diffs) |
| 23 | human | 3136 | HLA-H | major histocompatibility co... | NR_001434.4 | 59.6% | (many diffs) | |
| 24 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010815.1 | 54.4% | 50.1% | (many diffs) |
| 25 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010814.1 | 47.7% | 42.2% | (many diffs) |
| 26 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743373.1 | 29.3% | (many diffs) | |
| 27 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743374.1 | 28.2% | (many diffs) | |
| 28 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743376.1 | 27.6% | (many diffs) | |
| 29 | human | 3139 | HLA-L | major histocompatibility co... | NR_027822.1 | 15.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1161
- ORF length:
- 1095
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cgtcatggcg ccccgaaccc tcgtcctgct actctcgggg gccctggccc 121 tgacccagac ctgggcgggc tcccactcca tgaggtattt ctacacctcc gtgtcccggc 181 ccggccgcgg ggagccccgc ttcatcgccg tgggctacgt ggacgacacg cagttcgtgc 241 ggttcgacag cgacgccgcg agccagagga tggagccgcg ggcgccgtgg atagagcagg 301 aggggccgga gtattgggac cggaacacac ggaatgtgaa ggcccactca cagactgacc 361 gagagagcct gcggatcgcg ctccgctact acaaccagag cgaggacggt tctcacacca 421 tccagaggat gtatggctgc gacgtggggc cggacgggcg cttcctccgc gggtaccagc 481 aggacgctta cgacggcaag gattacatcg ccctgaacga ggacctgcgc tcttggaccg 541 cggcggacat ggcggctcag atcacccagc gcaagtggga gacggcccat gaggcggagc 601 agtggagagc ctacctggag ggccggtgcg tggagtggct ccgcagatac ctggagaacg 661 ggaaggagac gctgcagcgc acggacgccc ccaagacgca tatgactcac cacgctgtct 721 ctgaccatga ggccaccctg aggtgctggg cccTGAGCTT CTACCCTGCG GAGATCACAC 781 TGACCTGGCA GCGGGATGGG GAGGACCAGA CCCAGGACAC GGAGCTCGTG GAGACCAGGC 841 CTGCAGGGGA TGGGACCTTC CAGAAGTGGG CGTCTGTGGT GGTGCCTTCT GGACAGGAGC 901 AGAGATACAC CTGCCATGTG CAGCATGAGG GTCTGCCCAA GCCCCTCACC CTGAGATGGG 961 AGCCGTCTTC CCAGCCCACC ATCCCCATCG TGGGCATCAT TGCTGGCCTG GTTCTCTTTG 1021 GAGCTGTGAT CGCTGGAGCT GTGGTCGCTG CTGTGATGTG GAGGAGGAAG AGCTCAGATA 1081 GAAAAGGAGG GAGCTACTCT CAGGCTGCAA GCAGTGACAG TGCCCAGGGC TCTGATATGT 1141 CTCTCACAGC TTGTAAAGTG TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1201 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1261 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATAGA TAGCAAGTTG 1321 AAAACATAGT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt