Construct: ORF TRCN0000467545
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010801.2_s317c1
- Derived from:
- ccsbBroadEn_15296
- DNA Barcode:
- GTTCCGCTCAAGCCCTGCCCTCCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- STK32C (282974)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467545
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 282974 | STK32C | serine/threonine kinase 32C | NM_001318879.1 | 99.9% | 100% | 852T>C |
2 | human | 282974 | STK32C | serine/threonine kinase 32C | XM_011539693.2 | 99.9% | 100% | 852T>C |
3 | human | 282974 | STK32C | serine/threonine kinase 32C | XM_011539694.1 | 99.9% | 100% | 852T>C |
4 | human | 282974 | STK32C | serine/threonine kinase 32C | XM_011539695.1 | 99.9% | 100% | 852T>C |
5 | human | 282974 | STK32C | serine/threonine kinase 32C | XM_011539696.1 | 99.9% | 100% | 852T>C |
6 | human | 282974 | STK32C | serine/threonine kinase 32C | XM_024447947.1 | 99.9% | 100% | 852T>C |
7 | human | 282974 | STK32C | serine/threonine kinase 32C | XM_024447948.1 | 99.9% | 100% | 852T>C |
8 | human | 282974 | STK32C | serine/threonine kinase 32C | XM_024447949.1 | 99.9% | 100% | 852T>C |
9 | human | 282974 | STK32C | serine/threonine kinase 32C | NM_173575.4 | 75.8% | 75.9% | 1_351del;1203T>C |
10 | human | 282974 | STK32C | serine/threonine kinase 32C | XM_011539690.2 | 75% | 75.1% | 1_366del;1218T>C |
11 | human | 282974 | STK32C | serine/threonine kinase 32C | NM_001318878.2 | 73.8% | 73.9% | 1_390del;1242T>C |
12 | human | 282974 | STK32C | serine/threonine kinase 32C | XM_011539688.1 | 73.1% | 73.2% | 1_405del;1257T>C |
13 | human | 282974 | STK32C | serine/threonine kinase 32C | NR_134911.1 | 58.4% | (many diffs) | |
14 | human | 282974 | STK32C | serine/threonine kinase 32C | XR_945687.2 | 56.6% | (many diffs) | |
15 | mouse | 57740 | Stk32c | serine/threonine kinase 32C | NM_001162540.1 | 87% | 92.1% | (many diffs) |
16 | mouse | 57740 | Stk32c | serine/threonine kinase 32C | XM_006536216.3 | 73.2% | 77.5% | (many diffs) |
17 | mouse | 57740 | Stk32c | serine/threonine kinase 32C | NM_021302.3 | 66% | 69.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1173
- ORF length:
- 1107
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgta cgccatgaag tacatgaaca agcagcagtg catcgagcgc gacgaggtcc 121 gcaacgtctt ccgggagctg gagatcctgc aggagatcga gcacgtcttc ctggtgaacc 181 tctggtactc cttccaggac gaggaggaca tgttcatggt cgtggacctg ctactgggcg 241 gggacctgcg ctaccacctg cagcagaacg tgcagttctc cgaggacacg gtgaggctgt 301 acatctgcga gatggcactg gctctggact acctgcgcgg ccagcacatc atccacagag 361 atgtcaagcc tgacaacatt ctcctggatg agagaggaca tgcacacctg accgacttca 421 acattgccac catcatcaag gacggggagc gggcgacggc attagcaggc accaagccgt 481 acatggctcc ggagatcttc cactcttttg tcaacggcgg gaccggctac tccttcgagg 541 tggactggtg gtcggtgggg gtgatggcct atgagctgct gcgaggatgg aggccctatg 601 acatccactc cagcaacgcc gtggagtccc tggtgcagct gttcagcacc gtgagcgtcc 661 agtatgtccc cacgtggtcc aaggagatgg tggccttgct gcggaagctc ctcactgtga 721 accccgagca ccggctctcc agcctccagg acgtgcaggc agccccggcg ctggccGGCG 781 TGCTGTGGGA CCACCTGAGC GAGAAGAGGG TGGAGCCGGG CTTCGTGCCC AACAAAGGCC 841 GTCTGCACTG CGACCCCACC TTTGAGCTGG AGGAGATGAT CCTGGAGTCC AGGCCCCTGC 901 ACAAGAAGAA GAAGCGCCTG GCCAAGAACA AGTCCCGGGA CAACAGCAGG GACAGCTCCC 961 AGTCCGAGAA TGACTATCTT CAAGACTGCC TCGATGCCAT CCAGCAAGAC TTCGTGATTT 1021 TTAACAGAGA AAAGCTGAAG AGGAGCCAGG ACCTCCCGAG GGAGCCTCTC CCCGCCCCTG 1081 AGTCCAGGGA TGCTGCGGAG CCTGTGGAGG ACGAGGCGGA ACGCTCCGCC CTGCCCATGT 1141 GCGGCCCCAT TTGCCCCTCG GCCGGGAGCG GCTACCCAAC TTTCTTGTAC AAAGTGGTTG 1201 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1261 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGT 1321 TCCGCTCAAG CCCTGCCCTC CTACGCGTTA AGTCgacaat caacctctgg attacaaaat 1381 ttgtgaaaga tt