Transcript: Human XR_945687.2

PREDICTED: Homo sapiens serine/threonine kinase 32C (STK32C), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STK32C (282974)
Length:
1618
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_945687.2
NBCI Gene record:
STK32C (282974)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_945687.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000204920 CATGCACACCTGACCGACTTC pLKO.1 896 3UTR 100% 1.350 1.080 N STK32C n/a
2 TRCN0000361752 TCCAGCAAGACTTCGTGATTT pLKO_005 1567 3UTR 100% 13.200 9.240 N Stk32c n/a
3 TRCN0000007045 CCTGACAACATTCTCCTGGAT pLKO.1 866 3UTR 100% 2.640 1.848 N STK32C n/a
4 TRCN0000007043 CGACTTCAACATTGCCACCAT pLKO.1 910 3UTR 100% 2.640 1.848 N STK32C n/a
5 TRCN0000277882 CGACTTCAACATTGCCACCAT pLKO_005 910 3UTR 100% 2.640 1.848 N STK32C n/a
6 TRCN0000007046 GCACAAGAAGAAGAAGCGTCT pLKO.1 1396 3UTR 100% 2.160 1.512 N STK32C n/a
7 TRCN0000199748 GCTGTACATCTGCGAGATGGC pLKO.1 793 3UTR 100% 0.720 0.504 N STK32C n/a
8 TRCN0000318790 GCTGTACATCTGCGAGATGGC pLKO_005 793 3UTR 100% 0.720 0.504 N STK32C n/a
9 TRCN0000200014 CCAGATCCTTCGGGCCATTGG pLKO.1 475 3UTR 100% 0.000 0.000 N STK32C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_945687.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487986 TATAGGCATGGAACCCGGCATCTC pLX_317 18.1% 70.5% V5 (many diffs) n/a
2 ccsbBroadEn_13492 pDONR223 100% 56.6% None (many diffs) n/a
3 ccsbBroad304_13492 pLX_304 0% 56.6% V5 (many diffs) n/a
4 TRCN0000467915 TCGTTAGTTGTCAAATGCCAAACC pLX_317 37% 56.6% V5 (many diffs) n/a
5 ccsbBroadEn_15296 pDONR223 0% 56.6% None (many diffs) n/a
6 ccsbBroad304_15296 pLX_304 0% 56.6% V5 (many diffs) n/a
7 TRCN0000467545 GTTCCGCTCAAGCCCTGCCCTCCT pLX_317 36.1% 56.6% V5 (many diffs) n/a
Download CSV