Transcript: Mouse XM_006536216.3

PREDICTED: Mus musculus serine/threonine kinase 32C (Stk32c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stk32c (57740)
Length:
2038
CDS:
282..1604

Additional Resources:

NCBI RefSeq record:
XM_006536216.3
NBCI Gene record:
Stk32c (57740)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006536216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022770 CACCTTACTGACTTCAACATT pLKO.1 831 CDS 100% 5.625 7.875 N Stk32c n/a
2 TRCN0000022773 CGTCAGATATGACAGATTCCA pLKO.1 1510 CDS 100% 3.000 4.200 N Stk32c n/a
3 TRCN0000361743 ACTGTAGGTTGGCAGATTATA pLKO_005 1859 3UTR 100% 15.000 10.500 N Stk32c n/a
4 TRCN0000361750 AGGCCCAGAGACGTCAGATAT pLKO_005 1499 CDS 100% 13.200 9.240 N Stk32c n/a
5 TRCN0000361751 CAACATTGCCACCATCATAAA pLKO_005 845 CDS 100% 13.200 9.240 N Stk32c n/a
6 TRCN0000361752 TCCAGCAAGACTTCGTGATTT pLKO_005 1426 CDS 100% 13.200 9.240 N Stk32c n/a
7 TRCN0000022769 AGGATGTCTATGTCGTCCATA pLKO.1 392 CDS 100% 4.950 3.465 N Stk32c n/a
8 TRCN0000199340 CCTGTTTCAGTGGAGCAAGTG pLKO.1 364 CDS 100% 4.050 2.835 N STK32C n/a
9 TRCN0000277883 CCTGTTTCAGTGGAGCAAGTG pLKO_005 364 CDS 100% 4.050 2.835 N STK32C n/a
10 TRCN0000022771 TCGGAGAATGACTACCTGCAA pLKO.1 1389 CDS 100% 2.640 1.848 N Stk32c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006536216.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487986 TATAGGCATGGAACCCGGCATCTC pLX_317 18.1% 78.3% 75.3% V5 (many diffs) n/a
2 ccsbBroadEn_13492 pDONR223 100% 73.2% 77.5% None (many diffs) n/a
3 ccsbBroad304_13492 pLX_304 0% 73.2% 77.5% V5 (many diffs) n/a
4 TRCN0000467915 TCGTTAGTTGTCAAATGCCAAACC pLX_317 37% 73.2% 77.5% V5 (many diffs) n/a
5 ccsbBroadEn_15296 pDONR223 0% 73.2% 77.5% None (many diffs) n/a
6 ccsbBroad304_15296 pLX_304 0% 73.2% 77.5% V5 (many diffs) n/a
7 TRCN0000467545 GTTCCGCTCAAGCCCTGCCCTCCT pLX_317 36.1% 73.2% 77.5% V5 (many diffs) n/a
Download CSV