Transcript: Human NM_001318878.2

Homo sapiens serine/threonine kinase 32C (STK32C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
STK32C (282974)
Length:
2162
CDS:
145..1644

Additional Resources:

NCBI RefSeq record:
NM_001318878.2
NBCI Gene record:
STK32C (282974)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146198 GGGGACATACTGGACGCTCA pXPR_003 CGG 979 65% 8 1.1131 STK32C STK32C 76931
2 BRDN0001149411 GCAGAACGTGCAGTTCTCCG pXPR_003 AGG 604 40% 4 0.6692 STK32C STK32C 76933
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001318878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011064 CCTCGTCACAAGGTGACCCTT pLKO.1 1983 3UTR 100% 0.880 1.232 N STK32C n/a
2 TRCN0000007044 CAGTCCGAGAATGACTATCTT pLKO.1 1429 CDS 100% 5.625 4.500 N STK32C n/a
3 TRCN0000297057 CAGTCCGAGAATGACTATCTT pLKO_005 1429 CDS 100% 5.625 4.500 N STK32C n/a
4 TRCN0000199976 CCGGACACATTTCACACCTCA pLKO.1 1770 3UTR 100% 2.640 2.112 N STK32C n/a
5 TRCN0000204920 CATGCACACCTGACCGACTTC pLKO.1 868 CDS 100% 1.350 1.080 N STK32C n/a
6 TRCN0000361752 TCCAGCAAGACTTCGTGATTT pLKO_005 1469 CDS 100% 13.200 9.240 N Stk32c n/a
7 TRCN0000007045 CCTGACAACATTCTCCTGGAT pLKO.1 838 CDS 100% 2.640 1.848 N STK32C n/a
8 TRCN0000007043 CGACTTCAACATTGCCACCAT pLKO.1 882 CDS 100% 2.640 1.848 N STK32C n/a
9 TRCN0000277882 CGACTTCAACATTGCCACCAT pLKO_005 882 CDS 100% 2.640 1.848 N STK32C n/a
10 TRCN0000007046 GCACAAGAAGAAGAAGCGTCT pLKO.1 1368 CDS 100% 2.160 1.512 N STK32C n/a
11 TRCN0000199991 GCTCAGGTCTTGGAGGTCAAG pLKO.1 2034 3UTR 100% 1.350 0.945 N STK32C n/a
12 TRCN0000199380 CAGGAGTCTTTGTCCCTGCTC pLKO.1 1941 3UTR 100% 0.720 0.504 N STK32C n/a
13 TRCN0000286052 CAGGAGTCTTTGTCCCTGCTC pLKO_005 1941 3UTR 100% 0.720 0.504 N STK32C n/a
14 TRCN0000199748 GCTGTACATCTGCGAGATGGC pLKO.1 765 CDS 100% 0.720 0.504 N STK32C n/a
15 TRCN0000318790 GCTGTACATCTGCGAGATGGC pLKO_005 765 CDS 100% 0.720 0.504 N STK32C n/a
16 TRCN0000200014 CCAGATCCTTCGGGCCATTGG pLKO.1 462 CDS 100% 0.000 0.000 N STK32C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001318878.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487986 TATAGGCATGGAACCCGGCATCTC pLX_317 18.1% 87.6% 80.9% V5 (many diffs) n/a
2 ccsbBroadEn_13492 pDONR223 100% 73.8% 73.9% None 1_390del;1242T>C n/a
3 ccsbBroad304_13492 pLX_304 0% 73.8% 73.9% V5 1_390del;1242T>C n/a
4 TRCN0000467915 TCGTTAGTTGTCAAATGCCAAACC pLX_317 37% 73.8% 73.9% V5 1_390del;1242T>C n/a
5 ccsbBroadEn_15296 pDONR223 0% 73.8% 73.9% None 1_390del;1242T>C n/a
6 ccsbBroad304_15296 pLX_304 0% 73.8% 73.9% V5 1_390del;1242T>C n/a
7 TRCN0000467545 GTTCCGCTCAAGCCCTGCCCTCCT pLX_317 36.1% 73.8% 73.9% V5 1_390del;1242T>C n/a
Download CSV