Transcript: Human XM_005262310.3

PREDICTED: Homo sapiens zinc finger MYM-type containing 3 (ZMYM3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZMYM3 (9203)
Length:
5503
CDS:
137..4213

Additional Resources:

NCBI RefSeq record:
XM_005262310.3
NBCI Gene record:
ZMYM3 (9203)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262310.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219823 GTTGTACCGGGCTCAACTATT pLKO.1 3273 CDS 100% 13.200 18.480 N ZMYM3 n/a
2 TRCN0000219824 TGCGTATCAAAGAGGATATTC pLKO.1 3390 CDS 100% 13.200 18.480 N ZMYM3 n/a
3 TRCN0000161260 GCTTGTGCTGTATCACTTGTA pLKO.1 2154 CDS 100% 4.950 6.930 N ZMYM3 n/a
4 TRCN0000164744 CGGACCTTTACTACCTGACTT pLKO.1 3570 CDS 100% 4.950 3.960 N ZMYM3 n/a
5 TRCN0000098312 CCTGTGCTGTACCACTTCTTA pLKO.1 1711 CDS 100% 5.625 3.938 N Zmym3 n/a
6 TRCN0000165174 GAGGCAGACTTCCCTAAGAAT pLKO.1 3089 CDS 100% 5.625 3.938 N ZMYM3 n/a
7 TRCN0000160183 CCTGTGTAAGAACTTTGAGAT pLKO.1 1645 CDS 100% 4.950 3.465 N ZMYM3 n/a
8 TRCN0000159190 GAGAAACTCTTGCATGAGAAA pLKO.1 2051 CDS 100% 4.950 3.465 N ZMYM3 n/a
9 TRCN0000165445 GCATAGGTAGAGCCTCTTGTT pLKO.1 4571 3UTR 100% 4.950 3.465 N ZMYM3 n/a
10 TRCN0000165753 CCCTAAGAATCCTCTGGACAT pLKO.1 3100 CDS 100% 4.050 2.835 N ZMYM3 n/a
11 TRCN0000159967 CCTCCTATGAAATAATTGGTT pLKO.1 4762 3UTR 100% 3.000 2.100 N ZMYM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262310.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15662 pDONR223 0% 36.3% 36.1% None (many diffs) n/a
2 ccsbBroad304_15662 pLX_304 0% 36.3% 36.1% V5 (many diffs) n/a
3 TRCN0000467558 GCCCTCCTTGGGACTTACACACTT pLX_317 22.4% 36.3% 36.1% V5 (many diffs) n/a
Download CSV