Transcript: Human XM_017029647.2

PREDICTED: Homo sapiens histone deacetylase 8 (HDAC8), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HDAC8 (55869)
Length:
2059
CDS:
87..779

Additional Resources:

NCBI RefSeq record:
XM_017029647.2
NBCI Gene record:
HDAC8 (55869)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029647.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314872 AGTCGCTGGTCCCGGTTTATA pLKO_005 121 CDS 100% 15.000 21.000 N HDAC8 n/a
2 TRCN0000314874 TTACGATTGCGACGGAAATTT pLKO_005 573 CDS 100% 15.000 21.000 N HDAC8 n/a
3 TRCN0000004851 GCGTATTCTCTACGTGGATTT pLKO.1 596 CDS 100% 10.800 15.120 N HDAC8 n/a
4 TRCN0000350469 GCGTATTCTCTACGTGGATTT pLKO_005 596 CDS 100% 10.800 15.120 N HDAC8 n/a
5 TRCN0000004853 CCAATGCCTGATTGACGGAAT pLKO.1 455 CDS 100% 4.050 5.670 N HDAC8 n/a
6 TRCN0000314871 ATGTGCAAAGTAGCAATTAAC pLKO_005 474 CDS 100% 13.200 9.240 N HDAC8 n/a
7 TRCN0000004850 GCATTCTTTGATTGAAGCATA pLKO.1 209 CDS 100% 4.950 3.465 N HDAC8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029647.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08602 pDONR223 100% 59.9% 58.5% None (many diffs) n/a
2 ccsbBroad304_08602 pLX_304 0% 59.9% 58.5% V5 (many diffs) n/a
3 TRCN0000467791 AACTATTCCCAAGCGGCTCTCGTG pLX_317 32.5% 59.9% 58.5% V5 (many diffs) n/a
Download CSV