Construct: ORF TRCN0000467903
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012725.1_s317c1
- Derived from:
- ccsbBroadEn_06926
- DNA Barcode:
- ACCCCTACGCCCGACGTTATCCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SDHA (6389)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467903
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 6389 | SDHA | succinate dehydrogenase com... | NM_004168.4 | 99.9% | 100% | 891T>C |
2 | human | 6389 | SDHA | succinate dehydrogenase com... | XM_011514072.2 | 95.1% | 94.2% | (many diffs) |
3 | human | 6389 | SDHA | succinate dehydrogenase com... | NM_001294332.1 | 92.7% | 92.7% | 310_311ins144;747T>C |
4 | human | 6389 | SDHA | succinate dehydrogenase com... | NM_001330758.1 | 87.7% | 87.8% | 891T>C;1548_1549ins243 |
5 | human | 6389 | SDHA | succinate dehydrogenase com... | XM_011514073.2 | 83.3% | 82.3% | (many diffs) |
6 | human | 6389 | SDHA | succinate dehydrogenase com... | XM_017009685.2 | 82.9% | 81% | (many diffs) |
7 | human | 727956 | SDHAP2 | succinate dehydrogenase com... | NR_003265.3 | 81.2% | (many diffs) | |
8 | human | 6389 | SDHA | succinate dehydrogenase com... | XM_024446143.1 | 76.8% | 74.9% | (many diffs) |
9 | human | 255812 | SDHAP1 | succinate dehydrogenase com... | NR_003264.2 | 73.2% | (many diffs) | |
10 | human | 6389 | SDHA | succinate dehydrogenase com... | XR_002956167.1 | 36.2% | (many diffs) | |
11 | mouse | 66945 | Sdha | succinate dehydrogenase com... | NM_023281.1 | 86.6% | 94.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2058
- ORF length:
- 1992
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc gggggtccgg ggcctgtcgc ggctgctgag cgctcggcgc ctggcgctgg 121 ccaaggcgtg gccaacagtg ttgcaaacag gaacccgagg ttttcacttc actgttgatg 181 ggaacaagag ggcatctgct aaagtttcag attccatttc tgctcagtat ccagtagtgg 241 atcatgaatt tgatgcagtg gtggtaggcg ctggaggggc aggcttgcga gctgcatttg 301 gcctttctga ggcagggttt aatacagcat gtgttaccaa gctgtttcct accaggtcac 361 acactgttgc agcacaggga ggaatcaatg ctgctctggg gaacatggag gaggacaact 421 ggaggtggca tttctacgac accgtgaagg gctccgactg gctgggggac caggatgcca 481 tccactacat gacggagcag gcccccgccg ccgtggtcga gctagaaaat tatggcatgc 541 cgtttagcag aactgaagat gggaagattt atcagcgtgc atttggtgga cagagcctca 601 agtttggaaa gggcgggcag gcccatcggt gctgctgtgt ggctgatcgg actggccact 661 cgctattgca caccttatat ggaaggtctc tgcgatatga taccagctat tttgtggagt 721 attttgcctt ggatctcctg atggagaatg gggagtgccg tggtgtcatc gcactgtgca 781 tagaggacgg gtccatccat cgcataagag caaagaacac tgttgttgcc acaggaggct 841 acgggcgcac ctacttcagc tgcacgtctg cccacaccag cactggcgac ggcacggcca 901 tgatcaccag ggcaggcctt ccttgccagg acctagagtt tgttcagttc caccccacag 961 gcatatatgg tgctggttgt ctcattacgg aaggatgtcg tggagaggga ggcattctca 1021 ttaacagtca aggcgaaagg tttatggagc gatacgcccc tgtcgcgaag gacctggcgt 1081 ctagagatgt ggtgtctcgg tccatgactc tggagatccg agaaggaaga ggctgtggcc 1141 ctgagaaaga tcacgtctac ctgcagctgc accacctacc tccagagcag ctggccacgc 1201 gcctgcctgg catttcagag acagccatga tcttcgctgg cgtggacgtc acgaaggagc 1261 cgatccctgt cctccccacc gtgcattata acatgggcgg cattcccacc aactacaagg 1321 ggcaggtcct gaggcacgtg aatggccagg atcagattgt gcccggcctg tacgcctgtg 1381 gggaggccgc ctgtgcctcg gtacatggtg ccaaccgcct cggggcaaac tcgctcttgg 1441 acctggttgt ctttggtcgg gcatgtgccc tgagcatcga agagtcatgc aggcctggag 1501 ataaagtccc tccaattaaa ccaaacgctg gggaagaatc tgtcatgaat cttgacaaat 1561 tgagatttgc tgatggaagc ataagaacat cggaactgcg actcagcatg cagaagtcaa 1621 tgcaaaatca tgctgccgtg ttccgtgtgg gaagcgtgtt gcaagaaggt tgtgggaaaa 1681 tcagcaagct ctatggagac ctaaagcacc tgaagacgtt cgaccgggGA ATGGTCTGGA 1741 ACACGGACCT GGTGGAGACC CTGGAGCTGC AGAACCTGAT GCTGTGTGCG CTGCAGACCA 1801 TCTACGGAGC AGAGGCACGG AAGGAGTCAC GGGGCGCGCA TGCCAGGGAA GACTACAAGG 1861 TGCGGATTGA TGAGTACGAT TACTCCAAGC CCATCCAGGG GCAACAGAAG AAGCCCTTTG 1921 AGGAGCACTG GAGGAAGCAC ACCCTGTCCT ATGTGGACGT TGGCACTGGG AAGGTCACTC 1981 TGGAATATAG ACCCGTGATC GACAAAACTT TGAACGAGGC TGACTGTGCC ACCGTCCCGC 2041 CAGCCATTCG CTCCTACTGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 2101 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 2161 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAACCCCTA CGCCCGACGT 2221 TATCCCCACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt