Transcript: Human XR_002956167.1

PREDICTED: Homo sapiens succinate dehydrogenase complex flavoprotein subunit A (SDHA), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SDHA (6389)
Length:
5233
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956167.1
NBCI Gene record:
SDHA (6389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000028043 TCGCTATTGCACACCTTATAT pLKO.1 642 3UTR 100% 15.000 10.500 N SDHA n/a
2 TRCN0000278588 TCGCTATTGCACACCTTATAT pLKO_005 642 3UTR 100% 15.000 10.500 N SDHA n/a
3 TRCN0000028036 GCGATATGATACCAGCTATTT pLKO.1 674 3UTR 100% 13.200 7.920 N SDHA n/a
4 TRCN0000297154 GCGATATGATACCAGCTATTT pLKO_005 674 3UTR 100% 13.200 7.920 N SDHA n/a
5 TRCN0000028049 GAACTGAAGATGGGAAGATTT pLKO.1 532 3UTR 100% 13.200 6.600 Y LOC220729 n/a
6 TRCN0000028085 GATTTGCTGATGGAAGCATAA pLKO.1 1546 3UTR 100% 10.800 5.400 Y SDHA n/a
7 TRCN0000278536 GATTTGCTGATGGAAGCATAA pLKO_005 1546 3UTR 100% 10.800 5.400 Y SDHA n/a
8 TRCN0000036538 CCATCGCATAAGAGCAAAGAA pLKO.1 779 3UTR 100% 5.625 2.813 Y SDHAP1 n/a
9 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 4170 3UTR 100% 4.950 2.475 Y ERN2 n/a
10 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 4170 3UTR 100% 4.950 2.475 Y P3H4 n/a
11 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 4170 3UTR 100% 4.950 2.475 Y P3H4 n/a
12 TRCN0000028118 GCAAGCTCTATGGAGACCTAA pLKO.1 1666 3UTR 100% 4.950 2.475 Y SDHA n/a
13 TRCN0000278534 GCAAGCTCTATGGAGACCTAA pLKO_005 1666 3UTR 100% 4.950 2.475 Y SDHA n/a
14 TRCN0000036537 GCATGTGTTACCAAGCTGTTT pLKO.1 309 3UTR 100% 4.950 2.475 Y SDHAP1 n/a
15 TRCN0000220347 CGAAAGGTTTATGGAGCGATA pLKO.1 1016 3UTR 100% 4.050 2.025 Y LOC375386 n/a
16 TRCN0000028093 GCATCTGCTAAAGTTTCAGAT pLKO.1 174 3UTR 100% 0.495 0.248 Y SDHA n/a
17 TRCN0000297501 GCATCTGCTAAAGTTTCAGAT pLKO_005 174 3UTR 100% 0.495 0.248 Y SDHA n/a
18 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 4028 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956167.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06926 pDONR223 100% 36.2% None (many diffs) n/a
2 ccsbBroad304_06926 pLX_304 26.3% 36.2% V5 (many diffs) n/a
3 TRCN0000467903 ACCCCTACGCCCGACGTTATCCCC pLX_317 16.8% 36.2% V5 (many diffs) n/a
4 ccsbBroadEn_11124 pDONR223 100% 28.4% None (many diffs) n/a
5 ccsbBroad304_11124 pLX_304 0% 28.4% V5 (many diffs) n/a
6 TRCN0000481022 AAGATGCAAGGGTTATGCCCTGCC pLX_317 24.6% 28.4% V5 (many diffs) n/a
7 ccsbBroadEn_13737 pDONR223 100% 7.9% None (many diffs) n/a
8 ccsbBroad304_13737 pLX_304 0% 7.9% V5 (many diffs) n/a
9 TRCN0000470878 ATACAACTAGATCCCAGAAAGACT pLX_317 74.7% 7.9% V5 (many diffs) n/a
10 ccsbBroadEn_12783 pDONR223 100% 3.6% None (many diffs) n/a
11 ccsbBroad304_12783 pLX_304 0% 3.6% V5 (many diffs) n/a
12 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 3.6% V5 (many diffs) n/a
13 ccsbBroadEn_11616 pDONR223 100% 3.1% None (many diffs) n/a
14 ccsbBroad304_11616 pLX_304 0% 3.1% V5 (many diffs) n/a
15 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 3.1% V5 (many diffs) n/a
Download CSV