Construct: ORF TRCN0000468308
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016526.1_s317c1
- Derived from:
- ccsbBroadEn_12168
- DNA Barcode:
- GTCGAATCCCAGATCACAGTTCAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RBM23 (55147)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468308
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 55147 | RBM23 | RNA binding motif protein 23 | NM_001352765.2 | 99.6% | 99.7% | 360G>A;546C>T;1119_1120insGCC |
2 | human | 55147 | RBM23 | RNA binding motif protein 23 | NM_018107.5 | 99.6% | 99.7% | 360G>A;546C>T;1119_1120insGCC |
3 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_024449643.1 | 99.6% | 99.7% | 360G>A;546C>T;1119_1120insGCC |
4 | human | 55147 | RBM23 | RNA binding motif protein 23 | NM_001077351.2 | 95.9% | 95.9% | (many diffs) |
5 | human | 55147 | RBM23 | RNA binding motif protein 23 | NM_001352763.2 | 95.9% | 95.9% | (many diffs) |
6 | human | 55147 | RBM23 | RNA binding motif protein 23 | NM_001352766.2 | 95.9% | 95.9% | (many diffs) |
7 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_011536897.2 | 95.5% | 95.7% | (many diffs) |
8 | human | 55147 | RBM23 | RNA binding motif protein 23 | NM_001077352.2 | 95.4% | 95.5% | 352_353ins54;492C>T;1065_1066insGCC |
9 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021410.1 | 95.4% | 95.5% | 352_353ins54;492C>T;1065_1066insGCC |
10 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_024449642.1 | 93.6% | 93.7% | (many diffs) |
11 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021403.2 | 92.6% | 92.7% | (many diffs) |
12 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021404.1 | 92.6% | 92.7% | (many diffs) |
13 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021406.1 | 92.2% | 92.1% | (many diffs) |
14 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_011536900.2 | 91.9% | 91.8% | (many diffs) |
15 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021411.1 | 91.5% | 91.6% | (many diffs) |
16 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_011536892.2 | 90.2% | 90.3% | (many diffs) |
17 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_011536893.3 | 90.2% | 90.3% | (many diffs) |
18 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021401.2 | 89.4% | 89.4% | (many diffs) |
19 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021402.2 | 89.4% | 89.4% | (many diffs) |
20 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021400.2 | 89% | 89.2% | (many diffs) |
21 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021408.1 | 88.7% | 88.8% | (many diffs) |
22 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021409.1 | 88.3% | 88.2% | (many diffs) |
23 | human | 55147 | RBM23 | RNA binding motif protein 23 | NM_001352764.2 | 87.2% | 87.1% | (many diffs) |
24 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_011536895.3 | 86.4% | 86.5% | (many diffs) |
25 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_011536896.3 | 86.4% | 86.5% | (many diffs) |
26 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021405.2 | 85.7% | 85.5% | (many diffs) |
27 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021398.2 | 84.4% | 84.6% | (many diffs) |
28 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_011536894.2 | 83.6% | 83.4% | (many diffs) |
29 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_024449640.1 | 81.8% | 81.7% | (many diffs) |
30 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021399.2 | 80.9% | 81% | (many diffs) |
31 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_024449641.1 | 78.4% | 78.2% | (many diffs) |
32 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_024449646.1 | 69.7% | 69.1% | (many diffs) |
33 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_024449645.1 | 64.8% | 64.2% | (many diffs) |
34 | human | 55147 | RBM23 | RNA binding motif protein 23 | NM_001308044.2 | 63.3% | 63.4% | 0_1ins462;84C>T;657_658insGCC |
35 | human | 55147 | RBM23 | RNA binding motif protein 23 | NM_001352762.2 | 63.3% | 63.4% | 0_1ins462;84C>T;657_658insGCC |
36 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_011536902.1 | 63.3% | 63.4% | 0_1ins462;84C>T;657_658insGCC |
37 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_011536903.1 | 63.3% | 63.4% | 0_1ins462;84C>T;657_658insGCC |
38 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_011536904.1 | 63.3% | 63.4% | 0_1ins462;84C>T;657_658insGCC |
39 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_011536905.1 | 63.3% | 63.4% | 0_1ins462;84C>T;657_658insGCC |
40 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_011536906.1 | 63.3% | 63.4% | 0_1ins462;84C>T;657_658insGCC |
41 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021420.1 | 63.3% | 63.4% | 0_1ins462;84C>T;657_658insGCC |
42 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_024449644.1 | 61.4% | 61.1% | (many diffs) |
43 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021414.1 | 58.9% | 58.9% | (many diffs) |
44 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021415.1 | 58.9% | 58.9% | (many diffs) |
45 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021416.1 | 58.9% | 58.9% | (many diffs) |
46 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021417.1 | 58.9% | 58.9% | (many diffs) |
47 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021418.1 | 58.9% | 58.9% | (many diffs) |
48 | human | 55147 | RBM23 | RNA binding motif protein 23 | XM_017021419.1 | 58.9% | 58.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1338
- ORF length:
- 1272
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc atctgatgac tttgacatag tgattgaggc catgctggaa gctccctata 121 aaaaagaaga ggatgagcaa caaaggaaag aagttaaaaa ggattatcct agcaatacca 181 ccagcagcac cagcaacagt ggcaatgaga ccagtggaag cagcaccatc ggggagacaa 241 gcaatcgtag tcgagatcgg gatcggtata gacggagaaa tagtcggagc cgaagtccag 301 gtcggcagtg tcgtcaccgt agccgtagct gggatcgtcg acatggtagt gagtcgcgaa 361 gtcgggacca tcgtcgtgag gatcgtgtgc attacaggag tcctccactt gccactggtt 421 atagatatgg acacagtaag agtcctcatt tcagagagaa gagcccagtc agggagccag 481 ttgataatct gagtcctgag gagcgtgatg cccgcacagt tttctgtatg cagttagctg 541 cccgaattcg gcctcgagat ctggaggact ttttctctgc tgtaggcaag gttcgcgatg 601 tacgtatcat ttcagatcgg aactcacgtc gttctaaggg cattgcctac gtggaattct 661 gtgaaatcca gtctgtgcca ctggccattg ggctgactgg gcagcggttg ctgggagtgc 721 ctatcattgt acaggcttca caggcagaga aaaaccgact ggcagccatg gccaacaacc 781 tgcaaaaggg caatggtgga ccaatgcgcc tctatgtggg ttccctgcac ttcaatatca 841 ctgaagacat gctccggggc atctttgagc cctttggtaa aattgataat attgtccTGA 901 TGAAGGACTC AGATACAGGC CGCTCTAAAG GTTATGGTTT CATCACGTTC TCTGATTCTG 961 AGTGTGCCCG GCGGGCCCTG GAACAGTTGA ATGGGTTTGA GCTTGCTGGT CGACCTATGA 1021 GGGTTGGCCA TGTGACTGAG CGACTGGATG GTGGCACAGA CATCACTTTT CCTGATGGGG 1081 ACCAGGAGCT GGATCTGGGA TCAGCAGGTG GACGTTTTCA GCTCATGGCA AAACTGGCAG 1141 AAGGCGCTGG AATCCAACTG CCAAGCACTG CTGCTGCTGC TGCTGCCGCC GCCGCCGCCC 1201 AGGCTGCTGC CTTGCAACTG AATGGAGCAG TTCCCTTGGG GGCCCTGAAT CCAGCAGCTC 1261 TGACTGCTCT GAGTCCAGCC CTGAACCTTG CCTCCCAGTG TTTCCAGCTC TCCAGCCTCT 1321 TTACCCCCCA GACCATGTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1381 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1441 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAGTCGAAT CCCAGATCAC 1501 AGTTCAAACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt