Transcript: Human XM_017021418.1

PREDICTED: Homo sapiens RNA binding motif protein 23 (RBM23), transcript variant X32, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RBM23 (55147)
Length:
2558
CDS:
490..1395

Additional Resources:

NCBI RefSeq record:
XM_017021418.1
NBCI Gene record:
RBM23 (55147)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236394 GATCGGTATAGACGGAGAAAT pLKO_005 277 5UTR 100% 13.200 18.480 N RBM23 n/a
2 TRCN0000236390 TCAGATACAGGCCGCTCTAAA pLKO_005 871 CDS 100% 13.200 18.480 N RBM23 n/a
3 TRCN0000236393 ATGCTGGAAGCTCCCTATAAA pLKO_005 231 5UTR 100% 15.000 10.500 N RBM23 n/a
4 TRCN0000236391 GCCTCAACCCTGGCAATTATA pLKO_005 2303 3UTR 100% 15.000 10.500 N RBM23 n/a
5 TRCN0000148528 CCACCCTTAAGATACCAAGAA pLKO.1 1612 3UTR 100% 4.950 3.465 N RBM23 n/a
6 TRCN0000150168 CTTTCCAGTATCTTCCATCTT pLKO.1 2181 3UTR 100% 4.950 3.465 N RBM23 n/a
7 TRCN0000148856 CCAGTTGATAATCTGAGTCCT pLKO.1 439 5UTR 100% 2.640 1.848 N RBM23 n/a
8 TRCN0000146616 CTGCACTTCAATATCACTGAA pLKO.1 787 CDS 100% 4.950 2.970 N RBM23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021418.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12168 pDONR223 100% 58.9% 58.9% None (many diffs) n/a
2 ccsbBroad304_12168 pLX_304 0% 58.9% 58.9% V5 (many diffs) n/a
3 TRCN0000468308 GTCGAATCCCAGATCACAGTTCAA pLX_317 34.9% 58.9% 58.9% V5 (many diffs) n/a
Download CSV