Transcript: Human NM_001077352.2

Homo sapiens RNA binding motif protein 23 (RBM23), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
RBM23 (55147)
Length:
9905
CDS:
162..1379

Additional Resources:

NCBI RefSeq record:
NM_001077352.2
NBCI Gene record:
RBM23 (55147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001077352.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236394 GATCGGTATAGACGGAGAAAT pLKO_005 357 CDS 100% 13.200 18.480 N RBM23 n/a
2 TRCN0000236390 TCAGATACAGGCCGCTCTAAA pLKO_005 951 CDS 100% 13.200 18.480 N RBM23 n/a
3 TRCN0000236393 ATGCTGGAAGCTCCCTATAAA pLKO_005 198 CDS 100% 15.000 10.500 N RBM23 n/a
4 TRCN0000236391 GCCTCAACCCTGGCAATTATA pLKO_005 2207 3UTR 100% 15.000 10.500 N RBM23 n/a
5 TRCN0000148239 GATGAGCAACAAAGGAAAGAA pLKO.1 228 CDS 100% 5.625 3.938 N RBM23 n/a
6 TRCN0000148528 CCACCCTTAAGATACCAAGAA pLKO.1 1516 3UTR 100% 4.950 3.465 N RBM23 n/a
7 TRCN0000150168 CTTTCCAGTATCTTCCATCTT pLKO.1 2085 3UTR 100% 4.950 3.465 N RBM23 n/a
8 TRCN0000148856 CCAGTTGATAATCTGAGTCCT pLKO.1 519 CDS 100% 2.640 1.848 N RBM23 n/a
9 TRCN0000146616 CTGCACTTCAATATCACTGAA pLKO.1 867 CDS 100% 4.950 2.970 N RBM23 n/a
10 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 7557 3UTR 100% 10.800 5.400 Y MRPS16 n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3453 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3454 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 7557 3UTR 100% 10.800 5.400 Y CD3EAP n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7989 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 8176 3UTR 100% 2.640 1.320 Y LINC01098 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7989 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001077352.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12168 pDONR223 100% 95.4% 95.5% None 352_353ins54;492C>T;1065_1066insGCC n/a
2 ccsbBroad304_12168 pLX_304 0% 95.4% 95.5% V5 352_353ins54;492C>T;1065_1066insGCC n/a
3 TRCN0000468308 GTCGAATCCCAGATCACAGTTCAA pLX_317 34.9% 95.4% 95.5% V5 352_353ins54;492C>T;1065_1066insGCC n/a
Download CSV