Transcript: Mouse XM_006511152.2

PREDICTED: Mus musculus secretory carrier membrane protein 2 (Scamp2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scamp2 (24044)
Length:
2488
CDS:
128..1246

Additional Resources:

NCBI RefSeq record:
XM_006511152.2
NBCI Gene record:
Scamp2 (24044)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006511152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105427 TCCAGTTGATTGGCTTGCCTA pLKO.1 957 CDS 100% 2.640 3.696 N Scamp2 n/a
2 TRCN0000105425 GCCTTCTTTCTGAGGGTTCTT pLKO.1 2146 3UTR 100% 4.950 3.960 N Scamp2 n/a
3 TRCN0000105428 CCGACCCATCTACAAGGCTTT pLKO.1 865 CDS 100% 4.050 3.240 N Scamp2 n/a
4 TRCN0000105429 GCAGAACACTGCAGCGAATTT pLKO.1 574 CDS 100% 13.200 9.240 N Scamp2 n/a
5 TRCN0000105426 GCAGCCCTATCTACGATGAAA pLKO.1 1001 CDS 100% 5.625 3.938 N Scamp2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006511152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02302 pDONR223 100% 77% 78.4% None (many diffs) n/a
2 ccsbBroad304_02302 pLX_304 0% 77% 78.4% V5 (many diffs) n/a
3 TRCN0000468503 TTAGGTAGAGGGGTCTGCACTTTG pLX_317 33.2% 77% 78.4% V5 (many diffs) n/a
Download CSV