Transcript: Human NM_001323407.2

Homo sapiens proteasome inhibitor subunit 1 (PSMF1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
PSMF1 (9491)
Length:
6802
CDS:
283..810

Additional Resources:

NCBI RefSeq record:
NM_001323407.2
NBCI Gene record:
PSMF1 (9491)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221081 CCCTGAACTTGGATGATTATA pLKO.1 332 CDS 100% 15.000 10.500 N PSMF1 n/a
2 TRCN0000333486 CCCTGAACTTGGATGATTATA pLKO_005 332 CDS 100% 15.000 10.500 N PSMF1 n/a
3 TRCN0000221078 GCTGGGTGGAACAACAATAAA pLKO.1 184 5UTR 100% 15.000 10.500 N PSMF1 n/a
4 TRCN0000333546 GCTGGGTGGAACAACAATAAA pLKO_005 184 5UTR 100% 15.000 10.500 N PSMF1 n/a
5 TRCN0000221079 GTCTGGAATCATCACACCTAT pLKO.1 423 CDS 100% 4.950 3.465 N PSMF1 n/a
6 TRCN0000333487 GTCTGGAATCATCACACCTAT pLKO_005 423 CDS 100% 4.950 3.465 N PSMF1 n/a
7 TRCN0000221080 GCACTTATTGACCCTTCCTCA pLKO.1 676 CDS 100% 2.640 1.848 N PSMF1 n/a
8 TRCN0000333547 GCACTTATTGACCCTTCCTCA pLKO_005 676 CDS 100% 2.640 1.848 N PSMF1 n/a
9 TRCN0000066617 GCAGACTTGACCCTGAACTTA pLKO.1 322 CDS 100% 5.625 3.938 N Psmf1 n/a
10 TRCN0000325579 GCAGACTTGACCCTGAACTTA pLKO_005 322 CDS 100% 5.625 3.938 N Psmf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323407.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11374 pDONR223 100% 69.5% 57.4% None (many diffs) n/a
2 ccsbBroad304_11374 pLX_304 0% 69.5% 57.4% V5 (many diffs) n/a
3 TRCN0000470016 CCGTGTAAGATCCGAATACCGCAA pLX_317 62.8% 69.5% 57.4% V5 (many diffs) n/a
4 ccsbBroadEn_07428 pDONR223 100% 62.9% 62.7% None (many diffs) n/a
5 ccsbBroad304_07428 pLX_304 0% 62.9% 62.7% V5 (many diffs) n/a
6 TRCN0000468513 TACATAGCAGATTGTGTGAAATTA pLX_317 41.2% 62.9% 62.7% V5 (many diffs) n/a
Download CSV