Construct: ORF TRCN0000468698
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018043.1_s317c1
- Derived from:
- ccsbBroadEn_11307
- DNA Barcode:
- CTCCTACTGGGCCCTCTCAGATCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IL1RL2 (8808)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468698
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | NM_001351447.1 | 100% | 100% | |
| 2 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | NM_001351448.1 | 94.7% | 94.5% | 298_299ins72 |
| 3 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | NM_001351449.2 | 91.8% | 91% | (many diffs) |
| 4 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | NM_001351450.2 | 91.8% | 91% | (many diffs) |
| 5 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | XM_017005175.1 | 87.4% | 86.4% | (many diffs) |
| 6 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | XM_017005177.1 | 86.7% | 85.1% | (many diffs) |
| 7 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | XM_006712822.3 | 86.5% | 84.7% | (many diffs) |
| 8 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | XM_017005176.1 | 82.7% | 81.4% | (many diffs) |
| 9 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | XM_006712820.2 | 82.7% | 80.5% | (many diffs) |
| 10 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | XM_017005180.1 | 81.7% | 79.8% | (many diffs) |
| 11 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | NM_001351446.1 | 75.4% | 70.2% | (many diffs) |
| 12 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | NM_003854.4 | 75.4% | 70.2% | (many diffs) |
| 13 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | XM_017005174.2 | 73.1% | 69.4% | (many diffs) |
| 14 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | XM_011512091.1 | 72.4% | 69.2% | (many diffs) |
| 15 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | XM_011512092.1 | 72.4% | 70.3% | (many diffs) |
| 16 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | XM_011512094.1 | 71.8% | 66% | (many diffs) |
| 17 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | XM_011512093.1 | 68.5% | 65.2% | (many diffs) |
| 18 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | XM_011512096.1 | 63.6% | 60.3% | (many diffs) |
| 19 | human | 8808 | IL1RL2 | interleukin 1 receptor like 2 | XR_923053.2 | 36.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1440
- ORF length:
- 1371
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacagggctc gtgtccctgt catattttcc actctccacg aggtcctgcg 121 cgcttcaatc ctgcagcccg gtttggggat gtggtccttg ctgctctgcg ggttgtccat 181 cgcccttcca ctgtctgtca cagcaggact gtaacgagat taaaggggag cggttcactg 241 ttttggaaac caggcttttg gtgagcaatg tctcggcaga ggacagaggg aactacgcgt 301 gtcaagccat actgacacac tcagggaagc agtacgaggt tttaaatggc atcactgtga 361 gcattaaaag agctggatat ggaggaagtg tccctaaaat catttatcca aaaaatcatt 421 caattgaagt acagcttggt accactctga ttgtggactg caatgtaaca gacaccaagg 481 ataatacaaa tctacgatgc tggagagtca ataacacttt ggtggatgat tactatgatg 541 aatccaaacg aatcagagaa ggggtggaaa cccatgtctc ttttcgggaa cataatttgt 601 acacagtaaa catcaccttc ttggaagtga aaatggaaga ttatggcctt cctttcatgt 661 gccacgctgg agtgtccaca gcatacatta tattacagct cccagctccg gattttcgag 721 cttacttgat aggagggctt atcgccttgg tggctgtggc tgtgtctgtt gtgtacatat 781 acaacatttt taagatcgac attgttcttt ggtatcgaag tgccttccat tctacagaga 841 ccatagtaga tgggaagctg tatgacgcct atgtcttata ccccaagccc cacaaggaaa 901 gccagaggca tgccgtggat gccctggtgt tgaatatcct gcccgaggtg ttggagagac 961 aatgtggata taagttgttt atattcggca gagatgaaTT CCCTGGACAA GCCGTGGCCA 1021 ATGTCATCGA TGAAAACGTT AAGCTGTGCA GGAGGCTGAT TGTCATTGTG GTCCCCGAAT 1081 CGCTGGGCTT TGGCCTGTTG AAGAACCTGT CAGAAGAACA AATCGCGGTC TACAGTGCCC 1141 TGATCCAGGA CGGGATGAAG GTTATTCTCA TTGAGCTGGA GAAAATCGAG GACTACACAG 1201 TCATGCCAGA GTCAATTCAG TACATCAAAC AGAAGCATGG TGCCATCCGG TGGCATGGGG 1261 ACTTCACGGA GCAGTCACAG TGTATGAAGA CCAAGTTTTG GAAGACAGTG AGATACCACA 1321 TGCCGCCCAG AAGGTGTCGG CCGTTTCCTC CGGTCCAGCT GCTGCAGCAC ACACCTTGCT 1381 ACCGCACCGC AGGCCCAGAA CTAGGCTCAA GAAGAAAGAA GTGTACTCTC ACGACTGGCT 1441 TGCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1501 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1561 TTTATATATC TTGTGGAAAG GACGACTCCT ACTGGGCCCT CTCAGATCAA CGCGTTAAGT 1621 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt