Construct: ORF TRCN0000468787
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013546.1_s317c1
- Derived from:
- ccsbBroadEn_01773
- DNA Barcode:
- GTTCCTGTATACCGGATCGGATGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VIPR2 (7434)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468787
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | NM_003382.5 | 99.9% | 100% | 393A>C |
| 2 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_005249561.3 | 92.9% | 91% | (many diffs) |
| 3 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_006716107.2 | 89.2% | 87% | (many diffs) |
| 4 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446914.1 | 85% | 74.6% | 0_1ins71;188_333del;468A>C |
| 5 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446915.1 | 85% | 74.6% | 0_1ins71;188_333del;468A>C |
| 6 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | NM_001308259.1 | 83.3% | 76.5% | (many diffs) |
| 7 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | NM_001304522.1 | 81.7% | 81.7% | 356_357ins240 |
| 8 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446917.1 | 81.4% | 80% | (many diffs) |
| 9 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446916.1 | 79.5% | 78.6% | (many diffs) |
| 10 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_011516550.2 | 74% | 65.1% | (many diffs) |
| 11 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_006716108.3 | 72% | 68.4% | (many diffs) |
| 12 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_017012580.1 | 68.4% | 68.4% | 0_1ins414 |
| 13 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | XM_024446918.1 | 68.4% | 68.4% | 0_1ins414 |
| 14 | human | 7434 | VIPR2 | vasoactive intestinal pepti... | NR_130758.1 | 30.7% | 1_186del;1330_1663del;1835_4278del | |
| 15 | mouse | 22355 | Vipr2 | vasoactive intestinal pepti... | NM_009511.2 | 81.6% | 85.2% | (many diffs) |
| 16 | mouse | 22355 | Vipr2 | vasoactive intestinal pepti... | XM_006515805.1 | 79.1% | 82% | (many diffs) |
| 17 | mouse | 22355 | Vipr2 | vasoactive intestinal pepti... | XM_011244102.1 | 75.1% | 72.9% | (many diffs) |
| 18 | mouse | 22355 | Vipr2 | vasoactive intestinal pepti... | XM_006515806.3 | 72.5% | 75.9% | (many diffs) |
| 19 | mouse | 22355 | Vipr2 | vasoactive intestinal pepti... | XM_017315044.1 | 49.9% | 52.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1380
- ORF length:
- 1314
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttgacatgcg gacgctgctg cctcccgcgc tgctgacctg ctggctgctc gcccccgtga 121 acagcattca cccagaatgc cgatttcatc tggaaataca ggaggaagaa acaaaatgtg 181 cagagcttct gaggtctcaa acagaaaaac acaaagcctg cagtggcgtc tgggacaaca 241 tcacgtgctg gcggcctgcc aatgtgggag agaccgtcac ggtgccctgc ccaaaagtct 301 tcagcaattt ttacagcaaa gcaggaaaca taagcaaaaa ctgtacgagt gacggatggt 361 cagagacgtt cccagatttc gtcgatgcct gtggctacag cgacccggag gatgagagca 421 agatcacgtt ttatattctg gtgaaggcca tttataccct gggctacagt gtctctctga 481 tgtctcttgc aacaggaagc ataattctgt gcctcttcag gaagctgcac tgcaccagga 541 attacatcca cctgaacctg ttcctgtcct tcatcctgag agccatctca gtgctggtca 601 aggacgacgt tctctactcc agctctggca cgttgcactg ccctgaccag ccatcctcct 661 gggtgggctg caagctgagc ctggtcttcc tgcagtactg catcatggcc aacttcttct 721 ggctgctggt ggaggggctc tacctccaca ccctcctggt ggccatgctc ccccctagaa 781 ggtgcttcct ggcctacctc ctgatcggat ggggcctccc caccgtctgc atcggtgcat 841 ggactgcggc caggctctac ttagaagaca ccggttgctg ggatacaaac gaccacagtg 901 tgccctggtg ggTCATACGA ATACCGATTT TAATTTCCAT CATCGTCAAT TTTGTCCTTT 961 TCATTAGTAT TATACGAATT TTGCTGCAGA AGTTAACATC CCCAGATGTC GGCGGCAACG 1021 ACCAGTCTCA GTACAAGAGG CTGGCCAAGT CCACGCTCCT GCTTATCCCG CTGTTCGGCG 1081 TCCACTACAT GGTGTTTGCC GTGTTTCCCA TCAGCATCTC CTCCAAATAC CAGATACTGT 1141 TTGAGCTGTG CCTCGGGTCG TTCCAGGGCC TGGTGGTGGC CGTCCTCTAC TGTTTCCTGA 1201 ACAGTGAGGT GCAGTGCGAG CTGAAGCGAA AATGGCGAAG CCGGTGCCCG ACCCCGTCCG 1261 CGAGCCGGGA TTACAGGGTC TGCGGTTCCT CCTTCTCCCG CAACGGCTCG GAGGGCGCCC 1321 TGCAGTTCCA CCGCGGCTCC CGCGCCCAGT CCTTCCTGCA AACGGAGACC TCGGTCATCA 1381 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1441 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1501 TTTATATATC TTGTGGAAAG GACGAGTTCC TGTATACCGG ATCGGATGCA CGCGTTAAGT 1561 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt