Construct: ORF TRCN0000469005
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018868.3_s317c1
- Derived from:
- ccsbBroadEn_14923
- DNA Barcode:
- CAAGAGCTGTTCCTCTTCGGCGAA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- BRSK2 (9024)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469005
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | NM_003957.4 | 96.5% | 37.1% | (many diffs) |
| 2 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | NM_001256629.2 | 93.4% | 36.7% | (many diffs) |
| 3 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XM_005253218.3 | 88.7% | 34.4% | (many diffs) |
| 4 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | NM_001256627.2 | 87.5% | 33.6% | (many diffs) |
| 5 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XM_006718374.2 | 85.5% | 32.7% | (many diffs) |
| 6 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | NM_001282218.2 | 84.7% | 27.8% | (many diffs) |
| 7 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | NM_001256630.1 | 81.9% | 29.8% | (many diffs) |
| 8 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XM_011520462.2 | 80.5% | 26.1% | (many diffs) |
| 9 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XM_011520461.2 | 79.4% | 25.5% | (many diffs) |
| 10 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XM_006718376.2 | 77.7% | 24.8% | (many diffs) |
| 11 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XM_017018536.1 | 76.1% | 28.9% | (many diffs) |
| 12 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XM_017018533.1 | 74.6% | 28.1% | (many diffs) |
| 13 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XM_017018537.1 | 73.7% | 23.1% | (many diffs) |
| 14 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XM_017018535.1 | 69.1% | 21.9% | (many diffs) |
| 15 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XM_017018534.1 | 68.6% | 21.7% | (many diffs) |
| 16 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XM_017018532.1 | 67.9% | 21.3% | (many diffs) |
| 17 | human | 84446 | BRSK1 | BR serine/threonine kinase 1 | NM_032430.2 | 65.2% | 30.3% | (many diffs) |
| 18 | human | 84446 | BRSK1 | BR serine/threonine kinase 1 | XM_024451739.1 | 60.2% | 23.9% | (many diffs) |
| 19 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XR_930925.1 | 49.8% | (many diffs) | |
| 20 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XR_242831.2 | 49.3% | (many diffs) | |
| 21 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XR_002957207.1 | 49.2% | (many diffs) | |
| 22 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | NR_046331.2 | 46.8% | (many diffs) | |
| 23 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XR_001748025.1 | 45.5% | (many diffs) | |
| 24 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XR_930926.2 | 44.5% | (many diffs) | |
| 25 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XR_001748026.2 | 41.1% | (many diffs) | |
| 26 | human | 9024 | BRSK2 | BR serine/threonine kinase 2 | XM_017018538.1 | 40.4% | 2.8% | (many diffs) |
| 27 | mouse | 75770 | Brsk2 | BR serine/threonine kinase 2 | NM_029426.2 | 83.1% | 37.6% | (many diffs) |
| 28 | mouse | 75770 | Brsk2 | BR serine/threonine kinase 2 | NM_001009929.3 | 82.7% | 36.4% | (many diffs) |
| 29 | mouse | 75770 | Brsk2 | BR serine/threonine kinase 2 | NM_001276763.1 | 81.7% | 36.4% | (many diffs) |
| 30 | mouse | 75770 | Brsk2 | BR serine/threonine kinase 2 | NM_001009930.3 | 78.8% | 34.2% | (many diffs) |
| 31 | mouse | 381979 | Brsk1 | BR serine/threonine kinase 1 | NM_001168572.1 | 37.1% | 68.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 816
- ORF length:
- 747
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacatcgacg gggaaggacg gcggcgcgca gcacgcgcag tatgttgggc 121 cctaccggct ggagaagacg ctgggcaagg ggcagacagg tctggtgaag ctgggggttc 181 actgcgtcac ctgccagaag gtggccatca agatcgtcaa ccgtgagaag ctcagcgagt 241 cggtgctgat gaaggtggag cgggagatcg cgatcctgaa gctcattgag cacccccacg 301 tcctaaagct gcacgacgtt tatgaaaaca aaaaatattt gtacctggtg ctagaacacg 361 tgtcaggtgg tgagctcttc gactacctgg tgaagaaggg gaggctgacg cctaaggagg 421 ctcggaagtt cttccggcag atcatctctg cgctggactt ctgccacagc cactccatat 481 gccacaggga tctgaaacct gaaaacctcc tgctggacga gaagaacaac atccgcatcg 541 cagactttgg catggcgtcc ctgcaggttg gcgacagcct gttggagacc agctgtgggt 601 ccccccacta cgcctgcccc gaggtgatcc ggggggagaa gtatgacggc cggaaggcgg 661 acgtgtggag ctgcggcgtc atcctgttcg ccttgctggt gggggctctg cccttcgacg 721 atgacaactt gcgacagctg ctggagaagg tgaagcgggg cgtgttccac atgccgcact 781 ttatcccgcc cgactgccag agtctgctac gggcatgatc gaggtggacg cggcacgcgc 841 tcacgctaga gcacattcag accacatatg gtatataggg ggcaagaatg agcccgaacc 901 agagcagccc attcctcgca aggtgcagat ccgctcgctg cccagcctgg aggacatcga 961 ccccgacgtg ctggacagca tgcactcact gggctgcttc cgagaccgca acaagctgct 1021 gcaggacctg ctgtccgagg aggagaacca ggagaagatg atttacttcc tcctcctgga 1081 ccggaaagaa aggtacccga gccaggagga tgaggacctg cccccccgga acgagataga 1141 ccctccccgg aagcgtgtgg actccccgat gctgaaccgg cacggcaagc ggcggccaga 1201 acgcaaatcc atggaggtgc tcagcgtgac ggacggcggc tccccggtgc ttgcgcgggg 1261 cccatccccc aatttacgca aggaagaaag tttttgggtt ccttaaaggg ggcttccttg 1321 aggcttttcc caccagcccc atccaggagg cccccggggg gcccccttaa ccccttccac 1381 caagggccat tcccccctcc cccccccccc ccagggacac ctgtccacac gccaaaggag 1441 agcccggctg gcacgcccaa cccccaaggc ccccgtccag ccccagcgtc ggaggggtgc 1501 cctggagggc gcggctcaac tccatcaaga acagctttct gggctcaccc cgcttccacc 1561 gccggaaact gcaagttccg acgccggagg agatgtccaa cctgacacca gagtcgtccc 1621 cagagctggc gaagaagtcc tggtttggga acttcatcag cctggagaag gaggagcaga 1681 tcttcgtggt catcaaagac aaacctcTGA GCTCCATCAA GGCTGACATC GTGCACGCCT 1741 TCCTGTCGAT TCCCAGTCTC AGCCACAGCG TCATCTCCCA AACGAGCTTC CGGGCCGAGT 1801 ACAAGGCCAC GGGGGGGCCA GCCGTGTTCC AGAAGCCGGT CAAGTTCCAG GTTGATATCA 1861 CCTACACGGA GGGTGGGGAG GCGCAGAAGG AGAACGGCAT CTACTCCGTC ACCTTCACCC 1921 TGCTCTCAGG CCCCAGCCGT CGCTTCAAGA GGGTGGTGGA GACCATCCAG GCCCAGCTGC 1981 TGAGCACACA CGACCCGCCT GCGGCCCAGC ACTTGTCAGA CACCACTAAC TGTATGGAAA 2041 TGATGACGGG GCGGCTTTCC AAATGTGGAA TTATCCCGAA AAGTTTGCCA ACTTTCTTGT 2101 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 2161 AGTAATGAAC TAGTCCGTAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG 2221 AAAGGACGAC AAGAGCTGTT CCTCTTCGGC GAAACGCGTT AAGTCgacaa tcaacctctg 2281 gattacaaaa tttgtgaaag att