Transcript: Human NR_046331.2

Homo sapiens BR serine/threonine kinase 2 (BRSK2), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
BRSK2 (9024)
Length:
4153
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046331.2
NBCI Gene record:
BRSK2 (9024)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046331.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195215 CGAGCTACTGTAAACTTTAAA pLKO.1 3158 3UTR 100% 15.000 21.000 N BRSK2 n/a
2 TRCN0000219670 CTAAAGCTGCACGACGTTTAT pLKO.1 586 3UTR 100% 13.200 18.480 N BRSK2 n/a
3 TRCN0000000736 CACTAACTGTATGGAAATGAT pLKO.1 2390 3UTR 100% 5.625 3.938 N BRSK2 n/a
4 TRCN0000000739 CTGGACGAGAAGAACAACATC pLKO.1 796 3UTR 100% 4.950 3.465 N BRSK2 n/a
5 TRCN0000196971 GAAGTTCTTCCGGCAGATCAT pLKO.1 708 3UTR 100% 4.950 3.465 N BRSK2 n/a
6 TRCN0000000738 GCTCAACTCCATCAAGAACAG pLKO.1 1785 3UTR 100% 4.050 2.835 N BRSK2 n/a
7 TRCN0000000735 CAGTGTTATTTATTTGCCGTT pLKO.1 2998 3UTR 100% 2.160 1.512 N BRSK2 n/a
8 TRCN0000000737 GAACCAGGAGAAGATGATTTA pLKO.1 1332 3UTR 100% 13.200 7.920 N BRSK2 n/a
9 TRCN0000219669 TCGCGATCCTGAAGCTCATTG pLKO.1 551 3UTR 100% 10.800 6.480 N BRSK2 n/a
10 TRCN0000199348 CGATGACAACTTGCGACAGCT pLKO.1 1002 3UTR 100% 2.640 1.584 N BRSK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046331.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14923 pDONR223 81.1% 46.8% None (many diffs) n/a
2 ccsbBroad304_14923 pLX_304 0% 46.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469005 CAAGAGCTGTTCCTCTTCGGCGAA pLX_317 19% 46.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV