Transcript: Mouse NM_029426.2

Mus musculus BR serine/threonine kinase 2 (Brsk2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Brsk2 (75770)
Length:
4047
CDS:
336..2297

Additional Resources:

NCBI RefSeq record:
NM_029426.2
NBCI Gene record:
Brsk2 (75770)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_029426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079106 ACAGCGTTATTTCCCAGACAA pLKO.1 2023 CDS 100% 4.950 3.960 N Brsk2 n/a
2 TRCN0000363520 GCTGGGCTGAGACCAGTATTA pLKO_005 2789 3UTR 100% 13.200 9.240 N Brsk2 n/a
3 TRCN0000079105 GAGAGGAACAACATCCGTATT pLKO.1 789 CDS 100% 10.800 7.560 N Brsk2 n/a
4 TRCN0000363472 TGAAGGTGGAGCGAGAGATTG pLKO_005 520 CDS 100% 10.800 7.560 N Brsk2 n/a
5 TRCN0000079107 CTACTCAGTCACATTCACTTT pLKO.1 2159 CDS 100% 4.950 3.465 N Brsk2 n/a
6 TRCN0000079103 GCAGAGCTAGAGTTTGTGTTT pLKO.1 3126 3UTR 100% 4.950 3.465 N Brsk2 n/a
7 TRCN0000079104 GCGAGAGATTGCCATCTTGAA pLKO.1 530 CDS 100% 4.950 3.465 N Brsk2 n/a
8 TRCN0000363494 GCCTCAGCCACAGCGTTATTT pLKO_005 2014 CDS 100% 15.000 9.000 N Brsk2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_029426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14923 pDONR223 81.1% 83.1% 37.6% None (many diffs) n/a
2 ccsbBroad304_14923 pLX_304 0% 83.1% 37.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469005 CAAGAGCTGTTCCTCTTCGGCGAA pLX_317 19% 83.1% 37.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV