Transcript: Human XM_017018532.1

PREDICTED: Homo sapiens BR serine/threonine kinase 2 (BRSK2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRSK2 (9024)
Length:
4619
CDS:
191..2653

Additional Resources:

NCBI RefSeq record:
XM_017018532.1
NBCI Gene record:
BRSK2 (9024)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146828 GTGCTAGAACACGTGTCAGG pXPR_003 TGG 116 5% 4 0.5776 BRSK2 BRSK2 78025
2 BRDN0001147787 CATACCTATCTCGTTCCGGG pXPR_003 GGG 883 36% 11 0.3181 BRSK2 BRSK2 78027
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018532.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195215 CGAGCTACTGTAAACTTTAAA pLKO.1 3624 3UTR 100% 15.000 21.000 N BRSK2 n/a
2 TRCN0000219670 CTAAAGCTGCACGACGTTTAT pLKO.1 245 CDS 100% 13.200 18.480 N BRSK2 n/a
3 TRCN0000000736 CACTAACTGTATGGAAATGAT pLKO.1 2386 CDS 100% 5.625 3.938 N BRSK2 n/a
4 TRCN0000000739 CTGGACGAGAAGAACAACATC pLKO.1 455 CDS 100% 4.950 3.465 N BRSK2 n/a
5 TRCN0000196971 GAAGTTCTTCCGGCAGATCAT pLKO.1 367 CDS 100% 4.950 3.465 N BRSK2 n/a
6 TRCN0000000738 GCTCAACTCCATCAAGAACAG pLKO.1 1876 CDS 100% 4.050 2.835 N BRSK2 n/a
7 TRCN0000000735 CAGTGTTATTTATTTGCCGTT pLKO.1 3464 3UTR 100% 2.160 1.512 N BRSK2 n/a
8 TRCN0000000737 GAACCAGGAGAAGATGATTTA pLKO.1 991 CDS 100% 13.200 7.920 N BRSK2 n/a
9 TRCN0000219669 TCGCGATCCTGAAGCTCATTG pLKO.1 210 CDS 100% 10.800 6.480 N BRSK2 n/a
10 TRCN0000199348 CGATGACAACTTGCGACAGCT pLKO.1 661 CDS 100% 2.640 1.584 N BRSK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018532.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14923 pDONR223 81.1% 67.9% 21.3% None (many diffs) n/a
2 ccsbBroad304_14923 pLX_304 0% 67.9% 21.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469005 CAAGAGCTGTTCCTCTTCGGCGAA pLX_317 19% 67.9% 21.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV