Construct: ORF TRCN0000469074
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012970.1_s317c1
- Derived from:
- ccsbBroadEn_02709
- DNA Barcode:
- GTTCTTCCGAGACCTAACCCAAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SCMH1 (22955)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469074
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 22955 | SCMH1 | Scm polycomb group protein ... | NM_001031694.2 | 100% | 100% | |
2 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_011541033.2 | 100% | 100% | |
3 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_006710462.2 | 96% | 93.9% | (many diffs) |
4 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_011541032.2 | 96% | 93.9% | (many diffs) |
5 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_017000698.1 | 93.6% | 93.6% | 0_1ins60;1587_1588ins66 |
6 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_011541035.2 | 92.8% | 92.7% | 0_1ins141;2T>A |
7 | human | 22955 | SCMH1 | Scm polycomb group protein ... | NM_001172219.2 | 92.8% | 90.7% | (many diffs) |
8 | human | 22955 | SCMH1 | Scm polycomb group protein ... | NM_001172221.1 | 90.7% | 90.7% | 0_1ins183 |
9 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_006710464.1 | 90.7% | 90.7% | 0_1ins183 |
10 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_011541036.2 | 90.7% | 90.7% | 0_1ins183 |
11 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_017000699.1 | 90.7% | 90.7% | 0_1ins183 |
12 | human | 22955 | SCMH1 | Scm polycomb group protein ... | NM_012236.4 | 89.4% | 89.3% | 0_1ins141;2T>A;1506_1507ins66 |
13 | human | 22955 | SCMH1 | Scm polycomb group protein ... | NM_001172218.2 | 87.4% | 87.4% | 0_1ins183;1464_1465ins66 |
14 | human | 22955 | SCMH1 | Scm polycomb group protein ... | NM_001172220.2 | 87.4% | 87.4% | 0_1ins183;1464_1465ins66 |
15 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_011541034.1 | 87% | 79.5% | (many diffs) |
16 | human | 22955 | SCMH1 | Scm polycomb group protein ... | NM_001350667.2 | 85.8% | 81.4% | 0_1ins277;106_109delGTGA |
17 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_024454203.1 | 85.8% | 81.4% | 0_1ins277;106_109delGTGA |
18 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_024454204.1 | 85.8% | 81.4% | 0_1ins277;106_109delGTGA |
19 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_024454206.1 | 85.8% | 81.4% | 0_1ins277;106_109delGTGA |
20 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_017000700.1 | 83.6% | 77.9% | (many diffs) |
21 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_017000702.1 | 82.5% | 78.1% | 0_1ins277;106_109delGTGA;1374_1375ins66 |
22 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_017000703.1 | 82.5% | 78.1% | 0_1ins277;106_109delGTGA;1374_1375ins66 |
23 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XR_001737051.1 | 78.4% | (many diffs) | |
24 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_011541039.1 | 78.3% | 76.3% | (many diffs) |
25 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XR_946584.2 | 75.4% | (many diffs) | |
26 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_011541043.2 | 74.5% | 74.5% | 0_1ins504 |
27 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_011541044.1 | 74.5% | 74.5% | 0_1ins504 |
28 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_011541040.2 | 73.4% | 69.6% | (many diffs) |
29 | human | 22955 | SCMH1 | Scm polycomb group protein ... | NM_001172222.2 | 72.6% | 72.5% | (many diffs) |
30 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_017000708.1 | 72.5% | 72.5% | 0_1ins183;530_531ins360 |
31 | human | 22955 | SCMH1 | Scm polycomb group protein ... | NM_001350668.1 | 71.2% | 71.2% | 0_1ins504;1143_1144ins66 |
32 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_017000711.1 | 69.2% | 69.2% | 0_1ins183;530_531ins360;1104_1105ins66 |
33 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_017000712.1 | 69.2% | 69.2% | 0_1ins183;530_531ins360;1104_1105ins66 |
34 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XR_002959760.1 | 67.9% | (many diffs) | |
35 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XM_017000713.2 | 67.6% | 63.4% | 0_1ins277;106_109delGTGA;440_441ins360 |
36 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XR_002959763.1 | 67.6% | (many diffs) | |
37 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XR_002959762.1 | 67.5% | (many diffs) | |
38 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XR_002959761.1 | 65.2% | (many diffs) | |
39 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XR_001737054.1 | 61.2% | (many diffs) | |
40 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XR_001737045.1 | 59.4% | (many diffs) | |
41 | human | 22955 | SCMH1 | Scm polycomb group protein ... | NR_135092.1 | 58% | 1_369del;2017_2070del;2404_3412del | |
42 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XR_002959757.1 | 56% | (many diffs) | |
43 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XR_001737052.1 | 55% | (many diffs) | |
44 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XR_001737053.1 | 54.9% | (many diffs) | |
45 | human | 22955 | SCMH1 | Scm polycomb group protein ... | XR_001737046.1 | 54.1% | (many diffs) | |
46 | mouse | 29871 | Scmh1 | sex comb on midleg homolog 1 | NM_013883.2 | 90.6% | 93% | (many diffs) |
47 | mouse | 29871 | Scmh1 | sex comb on midleg homolog 1 | XM_011240551.1 | 90.6% | 93% | (many diffs) |
48 | mouse | 29871 | Scmh1 | sex comb on midleg homolog 1 | XM_017320252.1 | 90.6% | 93% | (many diffs) |
49 | mouse | 29871 | Scmh1 | sex comb on midleg homolog 1 | XM_017320253.1 | 90.6% | 93% | (many diffs) |
50 | mouse | 29871 | Scmh1 | sex comb on midleg homolog 1 | XM_011240550.1 | 87.6% | 86% | (many diffs) |
51 | mouse | 29871 | Scmh1 | sex comb on midleg homolog 1 | XM_011240552.1 | 87% | 89.4% | (many diffs) |
52 | mouse | 29871 | Scmh1 | sex comb on midleg homolog 1 | XM_017320254.1 | 85.5% | 87.8% | (many diffs) |
53 | mouse | 29871 | Scmh1 | sex comb on midleg homolog 1 | NM_001159630.1 | 85.1% | 87.1% | (many diffs) |
54 | mouse | 29871 | Scmh1 | sex comb on midleg homolog 1 | XM_006503149.2 | 82.6% | 80.9% | (many diffs) |
55 | mouse | 29871 | Scmh1 | sex comb on midleg homolog 1 | XM_006503150.3 | 81.6% | 84% | (many diffs) |
56 | mouse | 29871 | Scmh1 | sex comb on midleg homolog 1 | XR_001784154.1 | 55.6% | (many diffs) | |
57 | mouse | 29871 | Scmh1 | sex comb on midleg homolog 1 | XR_001784153.1 | 54.4% | (many diffs) | |
58 | mouse | 29871 | Scmh1 | sex comb on midleg homolog 1 | XR_001784155.1 | 21.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2046
- ORF length:
- 1980
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct ggtttgctac agtgttttag cttgtgagat tctctgggac cttccctgct 121 ccatcatggg gtcacctcta ggtcatttta cctgggacaa atacctaaaa gaaacatgtt 181 cagtcccagc gcctgtccat tgcttcaagc agtcctacac acctccaagc aacgagttca 241 agatcagtat gaaattggaa gcacaggacc ccaggaacac cacatccacc tgtattgcca 301 cagtagttgg actgacaggt gcccgccttc gcctgcgcct tgatgggagc gacaacaaaa 361 atgacttctg gcggctggtt gactcagctg aaatccagcc tattgggaac tgtgaaaaga 421 atgggggtat gctacagcca cctcttggat ttcggctgaa tgcgtcttct tggcccatgt 481 tccttttgaa gacgctaaat ggagcagaga tggctcccat caggattttc cacaaggagc 541 caccatcgcc ttcccacaac ttcttcaaaa tgggaatgaa gctagaagct gtggacagga 601 agaaccctca tttcatttgc ccagccacta ttggggaggt tcggggctca gaggtgcttg 661 tcacttttga tgggtggcga ggggcctttg actactggtg ccgcttcgac tcccgagaca 721 tcttccctgt gggctggtgt tccttgactg gagacaacct gcagcctcct ggcaccaaag 781 ttgtgattcc aaagaatccc tatcctgcct ccgatgtgaa tactgagaag cccagcatcc 841 acagcagcac caaaactgtc ttggaacatc aaccagggca gagggggcgt aaaccaggaa 901 agaagcgggg ccggacaccc aagaccctaa tttcccatcc catctctgcc ccatccaaga 961 cagctgaacc tttgaaattc ccaaagaaga gaggtcccaa acctggcagc aagaggaaac 1021 ctcggacttt gctgaaccca ccacctgcct caccaacaac cagcactcct gaaccggata 1081 ccagcactgt accccaggat gctgccacca tccccagctc agccatgcag gccccaacag 1141 tttgtatcta cttgaacaag aatggcagca caggccccca cttagataag aagaaggtcc 1201 agcaactccc tgaccatttt ggaccagccc gtgcctctgt ggtgttgcag caggctgtcc 1261 aggcctgtat cgactgtgct tatcaccaga aaaccgtctt cagcttcctc aagcaaggcc 1321 atggtggtga ggttatctca gccgtgtttg accgggaaca gcataccctc aacctcccag 1381 cagtcaacag catcacctac gtcctccgct tcctggagaa actctgccac aaccttcgta 1441 gtgacaatct gtttggcaac cagcccttta cacagactca cttgtcactc actgccatag 1501 agtacagcca cagccacgac aggtacctac caggtgaaac ctttgtcctg gggaatagtc 1561 tggcccgctc cttggaacca cactcagact caatggactc tgcctcaaat cccaccaacc 1621 ttgtcagcac ctcccaaagg caccggccct tgctttcatc ctgtggcctc ccaccaagca 1681 ctgccTCAGC TGTGCGCAGG CTATGCTCCA GGGGAGTGTT AAAAGGATCA AATGAAAGAA 1741 GGGATATGGA ATCATTTTGG AAACTAAATC GTTCCCCAGG GTCGGACCGA TACCTGGAGA 1801 GCCGCGATGC CTCTCGACTG AGTGGCCGGG ACCCCTCCTC ATGGACAGTC GAGGATGTGA 1861 TGCAGTTTGT CCGGGAAGCT GATCCTCAGC TTGGACCCCA CGCTGACCTG TTTCGCAAAC 1921 ACGAGATCGA TGGCAAGGCC CTGCTGCTGC TGCGCAGTGA CATGATGATG AAGTACATGG 1981 GCCTGAAGCT GGGGCCTGCA CTCAAGCTCT CCTACCACAT TGACCGGCTG AAGCAGGGCA 2041 AGTTCTGCCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 2101 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 2161 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGTTCTTCCG AGACCTAACC CAAGTACGCG 2221 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt