Transcript: Human NR_135092.1

Homo sapiens Scm polycomb group protein homolog 1 (SCMH1), transcript variant 8, non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
SCMH1 (22955)
Length:
3412
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135092.1
NBCI Gene record:
SCMH1 (22955)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135092.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416799 GGGCAAACCCTGTAGTTAATA pLKO_005 2881 3UTR 100% 15.000 21.000 N SCMH1 n/a
2 TRCN0000413985 ACAACCTTCGTAGTGACAATC pLKO_005 1733 3UTR 100% 10.800 15.120 N SCMH1 n/a
3 TRCN0000424392 AGGTTATCTCAGCCGTGTTTG pLKO_005 1634 3UTR 100% 10.800 15.120 N SCMH1 n/a
4 TRCN0000021810 GCCTGTATCGACTGTGCTTAT pLKO.1 1567 3UTR 100% 10.800 15.120 N SCMH1 n/a
5 TRCN0000432404 GGACACCCAAGACCCTAATTT pLKO_005 1217 3UTR 100% 15.000 10.500 N SCMH1 n/a
6 TRCN0000414895 AGTTCAAGATCAGTATGAAAT pLKO_005 539 3UTR 100% 13.200 9.240 N SCMH1 n/a
7 TRCN0000425850 CAATGGACTCTGCCTCAAATC pLKO_005 1895 3UTR 100% 10.800 7.560 N SCMH1 n/a
8 TRCN0000440334 GTTTGGCAACCAGCCCTTTAC pLKO_005 1755 3UTR 100% 10.800 7.560 N SCMH1 n/a
9 TRCN0000336312 TCATTTGCCCAGCCACTATTG pLKO_005 917 3UTR 100% 10.800 7.560 N Scmh1 n/a
10 TRCN0000021809 CCCAACAGTTTGTATCTACTT pLKO.1 1437 3UTR 100% 4.950 3.465 N SCMH1 n/a
11 TRCN0000021811 CCTCTTGGATTTCGGCTGAAT pLKO.1 745 3UTR 100% 4.950 3.465 N SCMH1 n/a
12 TRCN0000021813 GAACACCACATCCACCTGTAT pLKO.1 579 3UTR 100% 4.950 3.465 N SCMH1 n/a
13 TRCN0000097996 GCGCAGTGACATGATGATGAA pLKO.1 2310 3UTR 100% 4.950 3.465 N Scmh1 n/a
14 TRCN0000021812 GTCGAGGATGTGATGCAGTTT pLKO.1 2206 3UTR 100% 4.950 3.465 N SCMH1 n/a
15 TRCN0000097998 CCCTTTACACAGACTCACTTA pLKO.1 1768 3UTR 100% 4.950 3.465 N Scmh1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135092.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02709 pDONR223 100% 58% None 1_369del;2017_2070del;2404_3412del n/a
2 ccsbBroad304_02709 pLX_304 0% 58% V5 1_369del;2017_2070del;2404_3412del n/a
3 TRCN0000469074 GTTCTTCCGAGACCTAACCCAAGT pLX_317 18.5% 58% V5 1_369del;2017_2070del;2404_3412del n/a
4 ccsbBroadEn_02710 pDONR223 100% 52.6% None 1_552del;2017_2070del;2404_3412del n/a
5 ccsbBroad304_02710 pLX_304 0% 52.6% V5 1_552del;2017_2070del;2404_3412del n/a
Download CSV