Transcript: Human XR_002959762.1

PREDICTED: Homo sapiens Scm polycomb group protein homolog 1 (SCMH1), transcript variant X24, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCMH1 (22955)
Length:
2473
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959762.1
NBCI Gene record:
SCMH1 (22955)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959762.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413985 ACAACCTTCGTAGTGACAATC pLKO_005 1596 3UTR 100% 10.800 15.120 N SCMH1 n/a
2 TRCN0000424392 AGGTTATCTCAGCCGTGTTTG pLKO_005 1497 3UTR 100% 10.800 15.120 N SCMH1 n/a
3 TRCN0000021810 GCCTGTATCGACTGTGCTTAT pLKO.1 1430 3UTR 100% 10.800 15.120 N SCMH1 n/a
4 TRCN0000432404 GGACACCCAAGACCCTAATTT pLKO_005 1080 3UTR 100% 15.000 10.500 N SCMH1 n/a
5 TRCN0000414895 AGTTCAAGATCAGTATGAAAT pLKO_005 402 3UTR 100% 13.200 9.240 N SCMH1 n/a
6 TRCN0000425850 CAATGGACTCTGCCTCAAATC pLKO_005 2178 3UTR 100% 10.800 7.560 N SCMH1 n/a
7 TRCN0000440334 GTTTGGCAACCAGCCCTTTAC pLKO_005 1618 3UTR 100% 10.800 7.560 N SCMH1 n/a
8 TRCN0000336312 TCATTTGCCCAGCCACTATTG pLKO_005 780 3UTR 100% 10.800 7.560 N Scmh1 n/a
9 TRCN0000021809 CCCAACAGTTTGTATCTACTT pLKO.1 1300 3UTR 100% 4.950 3.465 N SCMH1 n/a
10 TRCN0000021811 CCTCTTGGATTTCGGCTGAAT pLKO.1 608 3UTR 100% 4.950 3.465 N SCMH1 n/a
11 TRCN0000021813 GAACACCACATCCACCTGTAT pLKO.1 442 3UTR 100% 4.950 3.465 N SCMH1 n/a
12 TRCN0000021812 GTCGAGGATGTGATGCAGTTT pLKO.1 2435 3UTR 100% 4.950 3.465 N SCMH1 n/a
13 TRCN0000097998 CCCTTTACACAGACTCACTTA pLKO.1 1631 3UTR 100% 4.950 3.465 N Scmh1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959762.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02709 pDONR223 100% 67.5% None (many diffs) n/a
2 ccsbBroad304_02709 pLX_304 0% 67.5% V5 (many diffs) n/a
3 TRCN0000469074 GTTCTTCCGAGACCTAACCCAAGT pLX_317 18.5% 67.5% V5 (many diffs) n/a
4 ccsbBroadEn_02710 pDONR223 100% 62.2% None 1_415del;1699_2118del;2473_2474ins159 n/a
5 ccsbBroad304_02710 pLX_304 0% 62.2% V5 1_415del;1699_2118del;2473_2474ins159 n/a
Download CSV