Transcript: Mouse XM_017320254.1

PREDICTED: Mus musculus sex comb on midleg homolog 1 (Scmh1), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scmh1 (29871)
Length:
8365
CDS:
5548..7437

Additional Resources:

NCBI RefSeq record:
XM_017320254.1
NBCI Gene record:
Scmh1 (29871)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017320254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336311 CCGAACACCCAAGATCCTTAT pLKO_005 6390 CDS 100% 10.800 8.640 N Scmh1 n/a
2 TRCN0000097999 CCACAGTTTGTATCTACTTGA pLKO.1 6614 CDS 100% 4.950 3.960 N Scmh1 n/a
3 TRCN0000336313 CTCACTGCCACAGAGTATAAT pLKO_005 6967 CDS 100% 15.000 10.500 N Scmh1 n/a
4 TRCN0000336251 GCTCCCAGGCCCTTCTATTTA pLKO_005 7635 3UTR 100% 15.000 10.500 N Scmh1 n/a
5 TRCN0000440334 GTTTGGCAACCAGCCCTTTAC pLKO_005 6930 CDS 100% 10.800 7.560 N SCMH1 n/a
6 TRCN0000336312 TCATTTGCCCAGCCACTATTG pLKO_005 6095 CDS 100% 10.800 7.560 N Scmh1 n/a
7 TRCN0000336314 TTCGAAGTGACAATCTGTTTG pLKO_005 6914 CDS 100% 10.800 7.560 N Scmh1 n/a
8 TRCN0000097998 CCCTTTACACAGACTCACTTA pLKO.1 6943 CDS 100% 4.950 3.465 N Scmh1 n/a
9 TRCN0000097997 CCTCTAGGATTTCGGCTGAAT pLKO.1 5923 CDS 100% 4.950 3.465 N Scmh1 n/a
10 TRCN0000021813 GAACACCACATCCACCTGTAT pLKO.1 5757 CDS 100% 4.950 3.465 N SCMH1 n/a
11 TRCN0000097995 GCCCTTCTATTTATTTCTCAA pLKO.1 7643 3UTR 100% 4.950 3.465 N Scmh1 n/a
12 TRCN0000090508 GCTGGCCTCAAACTCAGAAAT pLKO.1 1282 5UTR 100% 13.200 6.600 Y Dync1li1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017320254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02709 pDONR223 100% 85.5% 87.8% None (many diffs) n/a
2 ccsbBroad304_02709 pLX_304 0% 85.5% 87.8% V5 (many diffs) n/a
3 TRCN0000469074 GTTCTTCCGAGACCTAACCCAAGT pLX_317 18.5% 85.5% 87.8% V5 (many diffs) n/a
4 ccsbBroadEn_02710 pDONR223 100% 76.5% 78.7% None (many diffs) n/a
5 ccsbBroad304_02710 pLX_304 0% 76.5% 78.7% V5 (many diffs) n/a
Download CSV