Transcript: Human NR_147078.2

Homo sapiens ubiquitin specific peptidase 15 (USP15), transcript variant 12, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
USP15 (9958)
Length:
14985
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_147078.2
NBCI Gene record:
USP15 (9958)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_147078.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231592 GATACAGAGCACGTGATTATT pLKO_005 1706 3UTR 100% 15.000 21.000 N USP15 n/a
2 TRCN0000231591 TCCATCATATACCGCTTATAA pLKO_005 806 3UTR 100% 15.000 21.000 N USP15 n/a
3 TRCN0000231590 ATGTTGTAACTCGAAGATTTA pLKO_005 448 3UTR 100% 13.200 18.480 N USP15 n/a
4 TRCN0000356045 ATTTGTGGATGTTGGTCATTT pLKO_005 3303 3UTR 100% 13.200 18.480 N USP15 n/a
5 TRCN0000007566 CCTTGGAAGTTTACTTAGTTA pLKO.1 1435 3UTR 100% 5.625 7.875 N USP15 n/a
6 TRCN0000007565 CCGTAATCAATGTGGGCCTAT pLKO.1 3494 3UTR 100% 4.050 5.670 N USP15 n/a
7 TRCN0000007568 GCTCTTGAGAATGTGCCGATA pLKO.1 1855 3UTR 100% 4.050 5.670 N USP15 n/a
8 TRCN0000231593 GCAGGTCCTTGCCGCTATAAT pLKO_005 2633 3UTR 100% 15.000 12.000 N USP15 n/a
9 TRCN0000356043 TGCATTAGGCTGCCGTATATA pLKO_005 3390 3UTR 100% 15.000 12.000 N USP15 n/a
10 TRCN0000231594 CAGTATCAATGTGGCATAAAT pLKO_005 3430 3UTR 100% 15.000 10.500 N USP15 n/a
11 TRCN0000355989 CCTCCACTTACTGAGTATTTC pLKO_005 942 3UTR 100% 13.200 9.240 N USP15 n/a
12 TRCN0000231399 TGAGAGGTGAAATAGCTAAAT pLKO_005 1012 3UTR 100% 13.200 9.240 N Usp15 n/a
13 TRCN0000355993 TGAGAGGTGAAATAGCTAAAT pLKO_005 1012 3UTR 100% 13.200 9.240 N USP15 n/a
14 TRCN0000220548 GCACCTCAGTTCTCTGGATAT pLKO.1 1119 3UTR 100% 10.800 7.560 N Usp15 n/a
15 TRCN0000007569 GCTCACCAAGTGAAATGGAAA pLKO.1 1977 3UTR 100% 4.950 3.465 N USP15 n/a
16 TRCN0000007567 CCCATTGATAACTCTGGACTT pLKO.1 201 3UTR 100% 4.050 2.835 N USP15 n/a
17 TRCN0000356042 GCTGACACAATAGATACAATT pLKO_005 474 3UTR 100% 13.200 7.920 N USP15 n/a
18 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5294 3UTR 100% 13.200 6.600 Y LIAS n/a
19 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 13190 3UTR 100% 5.625 2.813 Y KLHL30 n/a
20 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 13190 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_147078.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07520 pDONR223 100% 19% None (many diffs) n/a
2 ccsbBroad304_07520 pLX_304 0% 19% V5 (many diffs) n/a
3 TRCN0000469190 GCCTTGCTGAGTAACATATGGGAT pLX_317 13% 19% V5 (many diffs) n/a
4 TRCN0000488082 AGTGACAACCTCGTTTCGCGTGAG pLX_317 10.8% 19% V5 (many diffs) n/a
5 TRCN0000489023 GGCGGAGTGAACTATACATGGATC pLX_317 10.5% 19% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_15686 pDONR223 0% 4.6% None (many diffs) n/a
7 ccsbBroad304_15686 pLX_304 0% 4.6% V5 (many diffs) n/a
8 TRCN0000474200 TGCGCAGACGAGACGCCTTTAGAA pLX_317 64.6% 4.6% V5 (many diffs) n/a
Download CSV