Transcript: Human NM_001351162.1

Homo sapiens ubiquitin specific peptidase 15 (USP15), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
USP15 (9958)
Length:
467
CDS:
76..324

Additional Resources:

NCBI RefSeq record:
NM_001351162.1
NBCI Gene record:
USP15 (9958)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007567 CCCATTGATAACTCTGGACTT pLKO.1 265 CDS 100% 4.050 2.835 N USP15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15686 pDONR223 0% 33.9% 32.3% None (many diffs) n/a
2 ccsbBroad304_15686 pLX_304 0% 33.9% 32.3% V5 (many diffs) n/a
3 TRCN0000474200 TGCGCAGACGAGACGCCTTTAGAA pLX_317 64.6% 33.9% 32.3% V5 (many diffs) n/a
4 ccsbBroadEn_07520 pDONR223 100% 8.3% 7.9% None (many diffs) n/a
5 ccsbBroad304_07520 pLX_304 0% 8.3% 7.9% V5 (many diffs) n/a
6 TRCN0000469190 GCCTTGCTGAGTAACATATGGGAT pLX_317 13% 8.3% 7.9% V5 (many diffs) n/a
7 TRCN0000489023 GGCGGAGTGAACTATACATGGATC pLX_317 10.5% 8.3% 7.9% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000488082 AGTGACAACCTCGTTTCGCGTGAG pLX_317 10.8% 8.3% 7.9% V5 (many diffs) n/a
Download CSV