Transcript: Mouse XM_006513225.3

PREDICTED: Mus musculus ubiquitin specific peptidase 15 (Usp15), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Usp15 (14479)
Length:
3045
CDS:
35..2254

Additional Resources:

NCBI RefSeq record:
XM_006513225.3
NBCI Gene record:
Usp15 (14479)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513225.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231593 GCAGGTCCTTGCCGCTATAAT pLKO_005 1916 CDS 100% 15.000 21.000 N USP15 n/a
2 TRCN0000220546 CGGGATGATATTTACGTGTTT pLKO.1 944 CDS 100% 4.950 6.930 N Usp15 n/a
3 TRCN0000220544 CGCTATAATTTGATTGCTGTT pLKO.1 1928 CDS 100% 4.050 5.670 N Usp15 n/a
4 TRCN0000220547 GCGCTTGTTTACATTCCAGTT pLKO.1 1435 CDS 100% 4.050 5.670 N Usp15 n/a
5 TRCN0000231398 CCCGTCATATACTGCTTATAA pLKO_005 103 CDS 100% 15.000 10.500 N Usp15 n/a
6 TRCN0000231400 TGACGAAGACAGCAATGATAA pLKO_005 2191 CDS 100% 13.200 9.240 N Usp15 n/a
7 TRCN0000231399 TGAGAGGTGAAATAGCTAAAT pLKO_005 309 CDS 100% 13.200 9.240 N Usp15 n/a
8 TRCN0000355993 TGAGAGGTGAAATAGCTAAAT pLKO_005 309 CDS 100% 13.200 9.240 N USP15 n/a
9 TRCN0000220548 GCACCTCAGTTCTCTGGATAT pLKO.1 416 CDS 100% 10.800 7.560 N Usp15 n/a
10 TRCN0000231401 TGTCTATGGAGATGAAGTTAT pLKO_005 2297 3UTR 100% 13.200 7.920 N Usp15 n/a
11 TRCN0000356045 ATTTGTGGATGTTGGTCATTT pLKO_005 2583 3UTR 100% 13.200 9.240 N USP15 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513225.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07520 pDONR223 100% 68.7% 74.2% None (many diffs) n/a
2 ccsbBroad304_07520 pLX_304 0% 68.7% 74.2% V5 (many diffs) n/a
3 TRCN0000469190 GCCTTGCTGAGTAACATATGGGAT pLX_317 13% 68.7% 74.2% V5 (many diffs) n/a
4 TRCN0000489023 GGCGGAGTGAACTATACATGGATC pLX_317 10.5% 68.7% 74.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000488082 AGTGACAACCTCGTTTCGCGTGAG pLX_317 10.8% 68.7% 74.2% V5 (many diffs) n/a
Download CSV