Transcript: Mouse XM_017318471.1

PREDICTED: Mus musculus cDNA sequence BC023829 (BC023829), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmem185a (236848)
Length:
2518
CDS:
420..1223

Additional Resources:

NCBI RefSeq record:
XM_017318471.1
NBCI Gene record:
Tmem185a (236848)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017318471.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251666 TGCGCTCTATGGATGTGATTG pLKO_005 760 CDS 100% 10.800 15.120 N Tmem185a n/a
2 TRCN0000265214 TACATCGTTTGGTCGGTTCTG pLKO_005 735 CDS 100% 4.050 5.670 N Tmem185a n/a
3 TRCN0000251663 ACAACGCAGAACACATATAAC pLKO_005 785 CDS 100% 13.200 9.240 N Tmem185a n/a
4 TRCN0000423680 GGGCTGTCTTTGCTCCAATAT pLKO_005 297 5UTR 100% 13.200 9.240 N TMEM185A n/a
5 TRCN0000251664 CATTGTCGTGCCTCTTCTTAC pLKO_005 827 CDS 100% 10.800 7.560 N Tmem185a n/a
6 TRCN0000251665 TGTCCCTCTGTGGATTCTCAT pLKO_005 686 CDS 100% 4.950 3.465 N Tmem185a n/a
7 TRCN0000428124 TTCGTTTGGATGGCATCATAC pLKO_005 264 5UTR 100% 10.800 7.560 N TMEM185A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017318471.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09200 pDONR223 100% 68.3% 76% None (many diffs) n/a
2 ccsbBroad304_09200 pLX_304 0% 68.3% 76% V5 (many diffs) n/a
3 TRCN0000469221 TTGGTGATGGAAGCTAACGGAAGT pLX_317 26.7% 68.3% 76% V5 (many diffs) n/a
4 ccsbBroadEn_10518 pDONR223 100% 62.2% 68% None (many diffs) n/a
5 ccsbBroad304_10518 pLX_304 0% 62.2% 68% V5 (many diffs) n/a
6 TRCN0000475283 TATGCATTGACCTGAGATATCGAT pLX_317 43.1% 62.2% 68% V5 (many diffs) n/a
7 ccsbBroadEn_14310 pDONR223 100% 56.3% 63.6% None (many diffs) n/a
8 ccsbBroad304_14310 pLX_304 0% 56.3% 63.6% V5 (many diffs) n/a
9 TRCN0000479165 CGTTTGGGAGTTTCCAGATCTTGG pLX_317 70.8% 56.3% 63.6% V5 (many diffs) n/a
Download CSV