Transcript: Human NM_024121.3

Homo sapiens transmembrane protein 185B (TMEM185B), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TMEM185B (79134)
Length:
5922
CDS:
425..1477

Additional Resources:

NCBI RefSeq record:
NM_024121.3
NBCI Gene record:
TMEM185B (79134)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_024121.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2910 3UTR 100% 5.625 2.813 Y KLHL30 n/a
2 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2910 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_024121.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10518 pDONR223 100% 99.9% 100% None 111A>G n/a
2 ccsbBroad304_10518 pLX_304 0% 99.9% 100% V5 111A>G n/a
3 TRCN0000475283 TATGCATTGACCTGAGATATCGAT pLX_317 43.1% 99.9% 100% V5 111A>G n/a
4 ccsbBroadEn_09200 pDONR223 100% 80.3% 88.5% None (many diffs) n/a
5 ccsbBroad304_09200 pLX_304 0% 80.3% 88.5% V5 (many diffs) n/a
6 TRCN0000469221 TTGGTGATGGAAGCTAACGGAAGT pLX_317 26.7% 80.3% 88.5% V5 (many diffs) n/a
Download CSV